Dataset for CDS Unclassified of organism Oncorhynchus kisutch

[Download (right click)]

7 sequence(s)

>gnl|bcl2dbcds|A0A8C7CXD6_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Oncorhynchus kisutch (length=687 residues).
atgatggcaaacgagaatccttataacagtcgctttattgtcgaaaaatacatccatcacaaactgttgaaagtgggatt
tgtatggaaatttcaaggagaaaacgattctccaaataatggctttggggacccctctacacccaactcccccgaagttt
ttgcacggaggtcccagcccactgccgcgggagaggacaccgactctccttaccaaaacaggagtccgcaacctgaccca
catgccaggctccacagggtcctgcgcgaggcgggtggcgagattgaaagaatgtatcagcgggactttgcagagatgtc
ggggcagttgcattttacacccagcacggcacagagaaggtttaccgctgtaatagatgagctcttcagcgacggggtaa
actggggtcggattgtggctttctttgagtttggagggacaatgtgcgtggagagcgtcaaccgggagatgacgtcccaa
gtagacaacatcgctcgttggatgacggagtacttaaacggacccctacagaactggatccaggagaatggtggctggga
cgcctttgtggagatctatgagcagcagaggatctctcactcctggccgtacttaaagacagtgttcggcctggccgccc
tgggagccgccggagtcaccatcggagccttgttcacccagaagtga
>gnl|bcl2dbcds|A0A8C7CXD6_uncBCL2-02 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Oncorhynchus kisutch (length=630 residues).
atgatggcaaacgagaatccttataacagtcgctttattgtcgaaaaatacatccatcacaaactgttgaaagtgggatt
tgtatggaaatttcaaggagaaaacgattctccaaataatggctttggggacccctctacacccaactcccccgaagttt
ttgcacggaggtcccagcccactgccgcgggagaggacaccgactctccttaccaaaacaggagtccgcaacctgaccca
catgccaggctccacagggtcctgcgcgaggcgggtggcgagattgaaagaatgtatcagcgggactttgcagagatgtc
ggggcagttgcattttacacccagcacggcacagagaaggtttaccgctgtaatagatgagctcttcagcgacggggtaa
actggggtcggattgtggctttctttgagtttggagggacaatgtgcgtggagagcgtcaaccgggagatgacgtcccaa
gtagacaacatcgctcgttggatgacggagtacttaaacggacccctacagaactggatccaggagaatggtggctgggt
ttgcaggtactgggcgggcggtagagtctgtctcacttctagacactgcagggatttcacctcatgctaa
>gnl|bcl2dbcds|A0A8C7CXD6_uncBCL2-03 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Oncorhynchus kisutch (length=630 residues).
atgatggcaaacgagaatccttataacagtcgctttattgtcgaaaaatacatccatcacaaactgttgaaagtgggatt
tgtatggaaatttcaaggagaaaacgattctccaaataatggctttggggacccctctacacccaactcccccgaagttt
ttgcacggaggtcccagcccactgccgcgggagaggacaccgactctccttaccaaaacaggagtccgcaacctgaccca
catgccaggctccacagggtcctgcgcgaggcgggtggcgagattgaaagaatgtatcagcgggactttgcagagatgtc
ggggcagttgcattttacacccagcacggcacagagaaggtttaccgctgtaatagatgagctcttcagcgacggggtaa
actggggtcggattgtggctttctttgagtttggagggacaatgtgcgtggagagcgtcaaccgggagatgacgtcccaa
gtagacaacatcgctcgttggatgacggagtacttaaacggacccctacagaactggatccaggagaatggtggctggcc
cctaccctccatgcctgctgggatgtctctaccgactggcaaaccaacatgtagaaacctacgaagatga
>gnl|bcl2dbcds|A0A8C7HGG9_uncBCL2L10-01 Putative BCL2-like 10 gene OS=[Eukaryota] Oncorhynchus kisutch (length=651 residues).
atgacagcgatcctccttccgtctgtacgtggagaaagcagtctgatcgctgggaggaccatgtcatgcgggctgtggaa
agaaaccctggctatagcagaggactacctgtctgtctgcagtattatccctgccagtgggtcctggaaagccccgcctg
gtcctcctcccagcgactcggctgcagccatgcggcaccaggcccgggacatggaggccaagcaccgggcccgcttccat
gccctggcacacagcttcctgtgccaatgcgggccggacccctgtgcctgtctgaggagggtgatggaggagctggtggg
agatggacagatgaactgggggagggtggtctctctgttcaccttcactggtgtgctggtcagagaactacagggagagg
acacagaccaggggctgggtaatggcatggagctgggggggaaggagcgctgcagggcactggcggagaccatagcagac
tacctaggagaggagaagagtgactggatgctggagaacaaaggctgggagggcttctgtaagttcttccacacagcaag
agaggtgaaccaggactcgtccatgaagactgccctgtttgctgctgctggcgtgggcatcgcagggttaaccttcctcc
tggtccgctaa
>gnl|bcl2dbcds|A0A8C7MJ69_uncMCL1-01 Putative Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oncorhynchus kisutch (length=621 residues).
atgttgtactccaatgatggctacgttacaatcgcaggtaccaaacattgcatgatctgtaaatcgccaccaggccaaga
tcattatatcgcatgccctgagattggtaaccgtctcaagacaaagctgaagcatctaaaactggcagggtctatcgaca
gcactcctttgttcacttggaaaggacctggacatgagtacaccctggacaccaacaccaggcaacttattaaatccgtc
ctaggacagtatacgagacttctgaaacctgggtggaacgaaagcaaagctctgtcgacaatgagtagagttgttggcca
attactacggaaacatagagacgcatacaatggtatgatcaacacactctacgtggatgacagaggggatgatgtgaagt
ttctcagtgcactagcccatatcatcttccaagacgggaccgttaactgtggccgtgttgccagcctgacatcttttggg
actgcggagatatcggcatacctgaacgggttcgtggacttctttccagtagcagaccccgagtccagctcgagaaacat
cctcatgttttttgtcagattggctggtattggggcagcagtgaccttgttggttatgtga
>gnl|bcl2dbcds|A0A8C7MNS2_uncMCL1-01 Putative Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oncorhynchus kisutch (length=921 residues).
atggcatgtcctgacattggtaaccgcgtcaaggcaacgttgaagcatctgaaagtggcagggtctatcgacagcactcc
tttgttcactagcagaggacctgaacatgagtacagatggggagacctcgaaacggatagctccttagcttacggcagca
aacactttggtgtactaggagagtctgccaacatgtaccaccttccaaatacggttgacacacacaaatgtttcatgtgt
aacctcgaaatcaagaactttgttgagaacgacaccctgctaggtgagcacatctttcacgtgtacaacacaagcggacg
ctgtaagtaccttaccgataggtacacgaatcgagaagacgagatgatgctcttactggggaaggaacggtacaggaggg
gaaaaattgcattccctgatagcatcatcaccaactcgaccggagccctggacaccgacaccaggcaactcattaaatgt
gtcctaggacaatgtacgggacttctgaaacctaggtggaacgaaagcaaagctctgtcaacaatgagtagagttatcgg
gcagttactagagaagcacagatacacatacaacggtatgatcaacacactctatgtggatgacagaggggataacgtga
agttcctcagtgcagtagcccatagcatctttgaagacgggaccgtcaactggggccgtgttgccagcaaggggagagac
aactgtgtggatttggtgggagaggagatatcagagtacctggtcactcaccacaaggactggctagtcaaacataactc
ctggaatgggttcgtggagttctttccagtagcagaacctgagtccagatgtcggaacatcatcatgaccatttttggat
tggctggtattggggcaacaatgaccttcttggttatgtga
>gnl|bcl2dbcds|A0A8C7MUB2_uncBCL2L10-01 Putative BCL2-like 10 gene OS=[Eukaryota] Oncorhynchus kisutch (length=651 residues).
atgacagcgatcctccttccgtctgtacgtggagaaagcagtctgatcgctgggaggaccatgtcatgcgggctgtggaa
agaaaccctggctatagcagaggactacctgtctgtctgcagtattatccctgccagtgggtcctggaaagccccgcctg
gtcctcctcccagcgactcggctgcagccatgcggcgccaggcccgggacatggaggccaagcaccgggcccgcttccat
gccctggcacacagcttcctgtgccaatgcgggccggacccctgtgcctgtctgaggagggtgatggaggagctggtggg
agatggacagatgaactgggggagggtggtctctctgttcaccttcactggtgtgctggtcagagaactacagggagagg
acacagaccaggggctgggtaatggcatggagctgggggggaaggagcgctgcagggcactggcggagaccatagcagac
tacctaggagaggagaagagtgactggatgctggagaacaaaggctgggagggcttctgtaagttcttccacacagcaag
agaggtgaaccaggactcgtccatgaagactgccctgtttgctgctgctggcgtgggcatcgcagggttaaccttcctcc
tggtccgctaa
© 1998-2022Legal notice