Dataset for CDS BAX-like of Organism Latimeria chalumnae

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

H3ASQ4_BAX-01       atgg-------------------caactcccgttaaaacggagggg--------tccgga
H3B8S5_BAK1-01      atgaaatggtactg---------ggactggcgtttgaatgagggtgaagccacttctcca
H3ABM8_BAX-01       atggcggatgagtgcggttgtgaggatagtcttggcagcgcggaggctgcctgggccgcg
H3AJU3_BOK-01       atgg-------------------agatgctc-----------------------------
                    ***                      *    *                             

H3ASQ4_BAX-01       aaagagaagaaagaaaaccaag---------gtggtgctggaggcactggagacgc----
H3B8S5_BAK1-01      gagcacagcgttatgtcctcggaaggtggcagtggtgatggcaacg-gtgagaagttggg
H3ABM8_BAX-01       ggagacagca----gtccccgg---------gctcagatgggga---gaaggacgcctg-
H3AJU3_BOK-01       -----cgacg----ctcctcgg---------tctttgctgccgaagtgatggaggtttt-
                                     *   *              * **           ** *     

H3ASQ4_BAX-01       ------------------------------agcagatga------g---cagctaaagca
H3B8S5_BAK1-01      ccgcactccagagaaagatgaaccactttccaggcacaacacagtgcaagatgtggtgcg
H3ABM8_BAX-01       ------------------ctagcaa-----cgcagataatgctacg---gagcagatctt
H3AJU3_BOK-01       ------------------tgaccgagcccccaccgataa------g---gagctggtgtc
                                                       *  *      *    *         

H3ASQ4_BAX-01       gcaagcaggaaacgtcttac---gtggatttatagtacagttgactcataatgatgacca
H3B8S5_BAK1-01      agagacggaggaggtgtttc---tgggatatgtacagtatcgataccagcaggagaga--
H3ABM8_BAX-01       acagacaggacaggtgttattaaaagggttcatcttggaccgaatccagcgtggtgtc--
H3AJU3_BOK-01       ccagtc-----------------caaggttc----tgtgccgggccta------tatc--
                      *  *                    * *                  *            

H3ASQ4_BAX-01       agaaatccatctcaggccagaggaccttggtggctctcagaacgat--------------
H3B8S5_BAK1-01      -gaacagaatatcgtgc---aggttcctgatgactatgagatcaatcagatcgaacagga
H3ABM8_BAX-01       -gaaacacggtgcgtgc---aagtgact--------ccagaccagctgggagtgacggag
H3AJU3_BOK-01       -cattcccggctgatcc---gggcta------------ggatcggctgggtgaagcccga
                      *             *     *                ** *                 

H3ASQ4_BAX-01       -------------atagaaaacccaaagacaaaggagattgttaacaatttaattaaaat
H3B8S5_BAK1-01      gcccaacagt---at-gacggcccaagtgggacagcggttggcaattatcggtgat----
H3ABM8_BAX-01       gagcagctgagcaat-cccagcttcaagaacttggcg------aactgtctgagacaaat
H3AJU3_BOK-01       atacagc------at-gccagcccccgga----ggca------aactggccgaggt----
                                 **      *            *        **               

H3ASQ4_BAX-01       tggagatgagcttaataagaatgttgaattgcagaggatgattgaaaatgttcccattgg
H3B8S5_BAK1-01      -------------gatattaacaagcggtatgatcgagagttcactgcaatgctgagcgc
H3ABM8_BAX-01       tggggatgagctggatgggaaccaggtgctccaaagagagatca-------gccgagtga
H3AJU3_BOK-01       ----------------------------------------gtcc-------gccg-----
                                                             *          *       

H3ASQ4_BAX-01       g-------tctgctcaggaagt--------gttttttca---agtagcacaaagcctatt
H3B8S5_BAK1-01      attaccactcaccatggagaatgcttatagttacttccagaaaatagctgagggtttatt
H3ABM8_BAX-01       agactgactcctcgaaagaagt--------cttctttcaggtggtgagagaggtgttctc
H3AJU3_BOK-01       --------tcc--------------------------------------------tgctc
                            **                                                * 

H3ASQ4_BAX-01       tgctgggggcattaactggggaaggatcgttgccctttt---------------------
H3B8S5_BAK1-01      tgactctggtattaactggggccgggtgatcgccctgttaggatttggttaccggatggc
H3ABM8_BAX-01       tgatgggaagttcaactggggccgcgtggtggcactctt---------------------
H3AJU3_BOK-01       cgactgggagatgagctggaat---------acattcgt---------------------
                     *         * * ****             *  *  *                     

H3ASQ4_BAX-01       -ctactttacctccaaacttgtacttaaggcaataacaaccaaccttagagaaataataa
H3B8S5_BAK1-01      gctcc-atgtctaccgacagggcttcacagggttcctcaccagcattgcccagtttgtgt
H3ABM8_BAX-01       -ctacttcgcctgcaagctgatcatcagggctttatgcgaaaacattcccaagatagtgc
H3AJU3_BOK-01       -ccaa-acgtctacagg------------------------aacattgccaa------ac
                     *        ** *                           * * **    *        

H3ASQ4_BAX-01       caaccatagtcaactggacattggatttcattgtacaaaatgtaatacggtgggttcgtg
H3B8S5_BAK1-01      ctcgattcct------------------tctgcagaacaggattgcacagtggattgctc
H3ABM8_BAX-01       ggaccatcattgagtggaccatggaatacctgcgggatcatgttgtccagtggatccggg
H3AJU3_BOK-01       agcttaacat------------------cttgc-----------------tgaattcgga
                             *                    *                   **  *     

H3ASQ4_BAX-01       aacaaggaggatgggaaaatgttcgcaataacttcta-----------------------
H3B8S5_BAK1-01      agcaaggtggatggg----tggcagcattggatcttg---------acaacgtttacatg
H3ABM8_BAX-01       aacaaggaggatgg------gacagcatctgcttgtacgtgaagagacacaattaccatg
H3AJU3_BOK-01       aacca---------------------------ttgtg-----------------------
                    * * *                           *  *                        

H3ASQ4_BAX-01       ----------------ctctatgaactggcagaatgtggcgttctttgcagcgggagtcc
H3B8S5_BAK1-01      aagtacttgctggctatcttgggagtggttctgattgggcactttgtgctgcg-------
H3ABM8_BAX-01       tgacaatgatt---tttctcaccggctttttggct---gcttttcttgtcatg-------
H3AJU3_BOK-01       -----------------------------tcggat---gcttttcttgc--tg-------
                                                      *   **  *   **    *       

H3ASQ4_BAX-01       ttaccggagttttggctttctggaaactgacttaa
H3B8S5_BAK1-01      -----------ccgtttcttcaaccattga-----
H3ABM8_BAX-01       -----------cggttctcctag------------
H3AJU3_BOK-01       -----------ttgct-------------------

© 1998-2023Legal notice