Dataset for CDS Unclassified of organism Pongo abelii

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A2J8SKI3_uncBCL2A1-01 Putative BCL2-related protein A1 gene OS=[Eukaryota] Pongo abelii (length=234 residues).
atggcgcgatctcggctcactgcaacctctgtctcccaggttcaggaaaatggctttgtaaagaagcttgagcctaaatc
tggctggatgacttttgaagttacaggaaagatctgtgaaatgctctcttctgaagcaatactgttgaccagaaaggaca
ctccatattgtgaaaccggcctaatttttctgactcttatgaaaacgattgccaacacatacttctacttttaa
© 1998-2023Centre National de la Recherche Scientifique logoInstitut national de la sante et de la recherche médicale logoUniversité de Lyon logoLegal notice