Dataset for CDS BOK of Organism Gadus morhua

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C4ZB81_BOK-01      atggaagtgcttcggaagtcctcagaattcgctgcggaggtgctggacgt
A0A8C4ZA97_BOK-01      atggagatgctccgtcgctcctcagtgttcgcggccgaagtgatggacgt
A0A8C4ZA97_BOK-02      atggagatgctccgtcgctcctcagtgttcgcggccgaagtgatggacgt
                       *****  **** **    *******  ***** ** ** *** *******

A0A8C4ZB81_BOK-01      gtttgaccgctcggtgagcgacaaggagctggtgttccaggccaaggcgc
A0A8C4ZA97_BOK-01      gtttgaccgctcgcccaccgataaggagctggtgtcccaggcgaaggcgc
A0A8C4ZA97_BOK-02      gtttgaccgctcgcccaccgataaggagctggtgtcccaggcgaaggcgc
                       *************   * *** ************* ****** *******

A0A8C4ZB81_BOK-01      tgtaccgagactacgtcctctgcaggctcaaccaacacgggtttgggtgg
A0A8C4ZA97_BOK-01      tgtgtagggactacatccactccagactcaaccgggccggtatcggctgg
A0A8C4ZA97_BOK-02      tgtgtagggactacatccactccagactcaaccgggccggtatcggctgg
                       ***   * ****** *** ** *** *******    ***  * ** ***

A0A8C4ZB81_BOK-01      gccaggagcgagctccacttcccctccac------cagtgcagcgctggc
A0A8C4ZA97_BOK-01      accaagccgga---ccacgggctgtctgcgtcgggcggcagcgcgctggg
A0A8C4ZA97_BOK-02      accaagccgga---ccacgggctgtctgcgtcgggcggcagcgcgctggg
                        *** *   **   ****   *  **  *      * *    ******* 

A0A8C4ZB81_BOK-01      cgaggtgtctctggtgctcctgtatctcggcgatgagttggagtgtatgc
A0A8C4ZA97_BOK-01      ggacacctcgtcggtcatcctgtggctaggtgatgagctggaatacctgc
A0A8C4ZA97_BOK-02      ggacacctcgtcggtcatcctgtggctaggtgatgagctggaatacctgc
                        **    **   ***  ******  ** ** ****** **** *   ***

A0A8C4ZB81_BOK-01      acccaagtctctacaggaacgtggctcggcaactcaacatttctgttgcc
A0A8C4ZA97_BOK-01      gcccgaacatctaccgtaacgtggcgaagcagctgaacatcaccgtggcg
A0A8C4ZA97_BOK-02      gcccgaacatctaccgtaacgtggcgaagcagctgaacatcaccgtggcg
                        *** *   ***** * ********   *** ** *****  * ** ** 

A0A8C4ZB81_BOK-01      atggagaatatggtatcggatgccttcattgctgtggcaacagagatctt
A0A8C4ZA97_BOK-01      tccgagagcatcgtgtccgacgccttcctagccgtcgccgccgagatctt
A0A8C4ZA97_BOK-02      tccgagagcatcgtgtccgacgccttcctagccgtcgccgccgagatctt
                          ****  ** ** ** ** ****** * ** ** **  * ********

A0A8C4ZB81_BOK-01      ttcaacag---------------------------gtataacatggggca
A0A8C4ZA97_BOK-01      ctccacaggacccttagctaaacacaccattacctgtgtgacgtggggga
A0A8C4ZA97_BOK-02      ctccacag---------------------------gtgtgacgtggggga
                        ** ****                           ** * ** ***** *

A0A8C4ZB81_BOK-01      aggtggtgtccatgttcgcagtggcggcgggtctggctgtggattgtgtg
A0A8C4ZA97_BOK-01      aggtggtctccctgtacgcggtggcgggggctctggcggtggactgcgtt
A0A8C4ZA97_BOK-02      aggtggtctccctgtacgcggtggcgggggctctggcggtggactgcgtt
                       ******* *** *** *** ******* ** ****** ***** ** ** 

A0A8C4ZB81_BOK-01      cggcagggccggccagccaccgtgcacgtccttgtggacagccttggcca
A0A8C4ZA97_BOK-01      cgtcatggccaccccgccatggtccacaccatcgtggactgcatggggga
A0A8C4ZA97_BOK-02      cgtcatggccaccccgccatggtccacaccatcgtggactgcatggggga
                       ** ** ****  ** ****  ** ***  * * ****** ** * **  *

A0A8C4ZB81_BOK-01      gctggtccgcaggtacctggtgccctggctcaagagaaagggaggctgga
A0A8C4ZA97_BOK-01      gttcgtccgtaagagcctgatcccctggctgaagaggcgcgggggatggg
A0A8C4ZA97_BOK-02      gttcgtccgtaagagcctgatcccctggctgaagaggcgcgggggatggg
                       * * ***** * *  **** * ******** *****    ** ** *** 

A0A8C4ZB81_BOK-01      cggaaattagcaaatgtgtcataaagaaggacgtcatctctgaacaccac
A0A8C4ZA97_BOK-01      tggacgtcaccaagtgtgtgatcaacaccgaccccagcttcagagcccat
A0A8C4ZA97_BOK-02      tggacgtcaccaagtgtgtgatcaacaccgaccccagcttcagagcccat
                        ***  * * *** ***** ** ** *  ***  ** **    *  *** 

A0A8C4ZB81_BOK-01      tggct------gtcctcca----ctgtgg--agtccttgaagtactttct
A0A8C4ZA97_BOK-01      tggctggtgtcggccgccagcacctgtggccagtacctgaag--------
A0A8C4ZA97_BOK-02      tggctggtgtcggccgccagcacctgtggccagtacctgaag--------
                       *****      * ** ***    ******  *** * *****        

A0A8C4ZB81_BOK-01      cactacagtttacgtatacgtcatgaaggaacaatga
A0A8C4ZA97_BOK-01      ----gcggtggtgttctacctgctgagggagaagtga
A0A8C4ZA97_BOK-02      ----gcggtggtgttctacctgctgagggagaagtga
                            * **     * *** *  *** ***  * ***

© 1998-2023Legal notice