Dataset for CDS MCL-1 of organism Macaca nemestrina

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K6ECR0_MCL1-03      atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgg
A0A2K6ECR0_MCL1-02      atgtttggcctcaaaagaaacgcggtaatcggactcaacctctactgtgg
                        **************************************************

A0A2K6ECR0_MCL1-03      gggggccggcttgggggccggcagcggcggcgccacccctccgggagggc
A0A2K6ECR0_MCL1-02      gggggccggcttgggggccggcagcggcggcgccacccctccgggagggc
                        **************************************************

A0A2K6ECR0_MCL1-03      ggcttttggccac--------------cggcgccaaggacacaaagccaa
A0A2K6ECR0_MCL1-02      ggcttttggctacggagaaggaggcctcggc-ccggcgagagataggggg
                        ********** **              **** **   ** * * **    

A0A2K6ECR0_MCL1-03      tgggcaggtc--------------tggggccaccagcaggaaggctctgg
A0A2K6ECR0_MCL1-02      aggggaggccggcacggtgattggcggaagcgccggcgcaagccccccgg
                         *** *** *               **   * ** **   *   * * **

A0A2K6ECR0_MCL1-03      -agaccttac----gacgggttggggatggcgtg----------------
A0A2K6ECR0_MCL1-02      ccgccctcacgccagacgcccggagggtcgcgcggccgccgcccattggc
                          * *** **    ****    * ** * *** *                

A0A2K6ECR0_MCL1-03      -----------------cagcgcaa---ccacgagacggccttcc-----
A0A2K6ECR0_MCL1-02      gcggaggtccccgacgtcaccgcgagccccgcgaggctgcttttctttgc
                                         ** *** *   ** **** * ** ** *     

A0A2K6ECR0_MCL1-03      --------------aaggcatgcttcggaaactggacatcaaaaacgaag
A0A2K6ECR0_MCL1-02      gcccacccgccgcgcggggccgcttgaggagatggaagccccggccgccg
                                        **   ****  * *  ****   *     **  *

A0A2K6ECR0_MCL1-03      acgatgtcaaatc-------------------------------------
A0A2K6ECR0_MCL1-02      acgccatcatgtcgcccgaagaggagctggacgggtacgagccggagcct
                        ***   ***  **                                     

A0A2K6ECR0_MCL1-03      ------------------------------------tttgtc------tc
A0A2K6ECR0_MCL1-02      ctcgggaagcggccggctgtcctgcccctgctggagttggtcggggaatc
                                                            ** ***      **

A0A2K6ECR0_MCL1-03      gagtgatggtccatgt-------------tttcagcgacggcgtaacaaa
A0A2K6ECR0_MCL1-02      tggtaatagccccagtacggatgggtcactaccctcgacgccgccgccag
                          ** ** * **  **             *  *  ***** **   * * 

A0A2K6ECR0_MCL1-03      ctggggcagga----------ttgt---gactctcatt--------tctt
A0A2K6ECR0_MCL1-02      cagagg-aggaggaggacgagttgtaccggcagtcgctggagattatctc
                        * * ** ****          ****   * *  **  *        *** 

A0A2K6ECR0_MCL1-03      ttggtgcctttgtg-gcgaaacacttg----aagaccataaa-ccaagaa
A0A2K6ECR0_MCL1-02      tcggtaccttcgggagcaggccaccggcgccaaggacacaaagccaatgg
                        * *** **** * * **    ***  *    ***  ** *** ****   

A0A2K6ECR0_MCL1-03      agctgcatcgaaccattagcagaaagtatc-acagacgttctcgtaagga
A0A2K6ECR0_MCL1-02      gcaggtctggggccaccagcaggaaggctctggagacctt------acga
                            *  * *  ***  ***** ***  **   **** **      * **

A0A2K6ECR0_MCL1-03      caaaacgggactggc---tagttaaacaaagaggctg--------ggatg
A0A2K6ECR0_MCL1-02      cgggttggggatggcgtgcagcgcaaccacgagacggccttccaaggatg
                        *     ***  ****    **   *** * *** * *        *****

A0A2K6ECR0_MCL1-03      ggtttgtggagttcttccatgtagaggacctagaaggtggcatcagaaat
A0A2K6ECR0_MCL1-02      ggtttgtggagttcttccatgtagaggacctagaaggtggcatcagaaat
                        **************************************************

A0A2K6ECR0_MCL1-03      gtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
A0A2K6ECR0_MCL1-02      gtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
                        **************************************************

A0A2K6ECR0_MCL1-03      tctaataagatag-----------
A0A2K6ECR0_MCL1-02      tctaataagatagccttactgtaa
                        *************           

© 1998-2020Legal notice