Dataset for CDS BCL2L10 of organism Homo sapiens

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

Q9HD36_BCL2L10-01      atggttgaccagttgcgggagcgcaccaccatggccgacccgctgcggga
Q9HD36_BCL2L10-02      atggttgaccagttgcgggagcgcaccaccatggccgacccgctgcggga

Q9HD36_BCL2L10-01      gcgcaccgagctgttgctggccgactacctggggtactgcgcccgggaac
Q9HD36_BCL2L10-02      gcgcaccgagctgttgctggccgactacctggggtactgcgcccgggaac

Q9HD36_BCL2L10-01      ccggcacccccgagccggcgccatccacgcccgaggccgccgtgctgcgc
Q9HD36_BCL2L10-02      ccggcacccccgagccggcgccatccacgcccgaggccgccgtgctgcgc

Q9HD36_BCL2L10-01      tccgcggccgccaggttacggcagattcaccggtcctttttctccgccta
Q9HD36_BCL2L10-02      tccgcggccgccaggttacggcagattcaccggtcctttttctccgccta

Q9HD36_BCL2L10-01      cctcggctaccccgggaaccgcttcgagctggtggcgctgatggcggatt
Q9HD36_BCL2L10-02      cctcggctaccccgggaaccgcttcgagctggtggcgctgatggcggatt

Q9HD36_BCL2L10-01      ccgtgctctccgacagccccggccccacctggggcagagtggtgacgctc
Q9HD36_BCL2L10-02      ccgtgctctccgacagccccggccccacctggggcagagtggtgacgctc

Q9HD36_BCL2L10-01      gtgaccttcgcagggacgctgctggagagagggccgctggtgaccgcccg
Q9HD36_BCL2L10-02      gtgaccttcgcagggacgctgctggagagagggccgctggtgaccgcccg

Q9HD36_BCL2L10-01      gtggaagaagtggggcttccagccgcggctaaaggagcaggagggcgacg
Q9HD36_BCL2L10-02      gtggaagaagtggggcttccagccgcggctaaaggagcaggagggcgacg

Q9HD36_BCL2L10-01      tcgcccgggactgccagcgcctggtggccttgctgagctcgcggctcatg
Q9HD36_BCL2L10-02      tcgcccgggactgccagcgcctggtggccttgctgagctcgcggctcatg

Q9HD36_BCL2L10-01      gggcagcaccgcgcctggctgcaggctcagggcggctg------------
Q9HD36_BCL2L10-02      gggcagcaccgcgcctggctgcaggctcagggcggctgggtgagcacgcg

Q9HD36_BCL2L10-01      --------------------------------------------------
Q9HD36_BCL2L10-02      gcggacaccgggacacggggcgggacgggcagccgggaagcgcccacgag

Q9HD36_BCL2L10-01      --------ggatggcttttgtcacttcttcaggaccccctttccactggc
Q9HD36_BCL2L10-02      gctggcacggatggcttttgtcacttcttcaggaccccctttccactggc

Q9HD36_BCL2L10-01      tttttggagaaaacagctggtccaggcttttctgtcatgcttgttaacaa
Q9HD36_BCL2L10-02      tttttggagaaaacagctggtccaggcttttctgtcatgcttgttaacaa

Q9HD36_BCL2L10-01      cagccttcatttatctctggacacgattattatga---------------
Q9HD36_BCL2L10-02      cagccttcatttatctctggacacgattattatgagttttaaaactttta

Q9HD36_BCL2L10-01      --------------------------
Q9HD36_BCL2L10-02      acccgcttctacctgcccaactgtga

© 1998-2021Legal notice