Dataset for CDS BCL-2-like of organism Oryzias melastigma

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3B3C5I4_BCL2L10      atg------------------gatggtt--tttctgc-------------
A0A3B3E2W4_BCL2L1-      atgtcccact-gtaaccgagagctggtgcagttctattt-----------
A0A3B3DHA1_BCL2L1-      atgtccc----gcaacagagaactggttgttttctacgt-----------
A0A3B3CEX1_MCL1-01      atgcttcctttgcaa-aaacacatggttaacagctacattacgccgagct
A0A3B3CEX1_MCL1-02      atgcttcctttgcaa-aaacacatggttaacagctacattacgccgagct
                        ***                    ****      **               

A0A3B3C5I4_BCL2L10      ------------------tcagaa--------------------------
A0A3B3E2W4_BCL2L1-      -aggctataagatgtcatccagag--------------------------
A0A3B3DHA1_BCL2L1-      ---gaagtataaactgtctcagaggaac----------------------
A0A3B3CEX1_MCL1-01      gtggatgtacggcactcttcggcggagcgggagagagatccgcgcgcgtg
A0A3B3CEX1_MCL1-02      gtggatgtacggcactcttcggcggagcgggagagagatccgcgcgcgtg
                                           * *                            

A0A3B3C5I4_BCL2L10      ---------------aatgtcttgtg----------------------gg
A0A3B3E2W4_BCL2L1-      ---------------actatcctgtg---------tccctgctgaaaccc
A0A3B3DHA1_BCL2L1-      -----taccccctcaaccacatagtgctcaatgagtc--------tccga
A0A3B3CEX1_MCL1-01      cctctgacctccgccacggcctcgcgcggcgctaatcccgacccgtccga
A0A3B3CEX1_MCL1-02      cctctgacctccgccacggcctcgcgcggcgctaatcccgacccgtccga
                                       *       * *                        

A0A3B3C5I4_BCL2L10      ctgaggaaagagaccctagctgtggccctggat-----------tacctg
A0A3B3E2W4_BCL2L1-      acagatgatggg-----------------ggacaaactgcagaggaccgc
A0A3B3DHA1_BCL2L1-      acag-------gactgctgcgggggaggtgggcgaggagcagagcacaga
A0A3B3CEX1_MCL1-01      acagatgaaaagaccgc-----aggacctcgacatgttagggaataaatc
A0A3B3CEX1_MCL1-02      acagatgaaaagaccgc-----aggacctcgacatgttagggaataaatc
                                   *                  *              *    

A0A3B3C5I4_BCL2L10      tccctgagctgcaggagcccagtc---------------------ctcca
A0A3B3E2W4_BCL2L1-      tctgctacctgcaacggcacactggtcaacagcgaggacggccagctgaa
A0A3B3DHA1_BCL2L1-      gacgcacgc--caacgggacgtttaacgg-gacga----------gtccc
A0A3B3CEX1_MCL1-01      tccgtatgc--ggcgaggaggtttcacgacgacgacggcggctctctccc
A0A3B3CEX1_MCL1-02      tccgtatgc--ggcgaggaggtttcacgacgacgacggcggctctctccc
                                *       *     *                       *   

A0A3B3C5I4_BCL2L10      ggcccccccacctc-----ccagcgagtcagcttc---------------
A0A3B3E2W4_BCL2L1-      gaa-gtcctgcccctgt------tgtgctagca-----------------
A0A3B3DHA1_BCL2L1-      ggg-accccgccgctatccccgctgcgtcagcagca-----gttgccgtc
A0A3B3CEX1_MCL1-01      gaacaccccggagctgg----agtgcgacaacagcgtacttgtacccaac
A0A3B3CEX1_MCL1-02      gaacaccccggagctgg----agtgcgacaacagcgtacttgtacccaac
                        *     **     *          * *  * *                  

A0A3B3C5I4_BCL2L10      --------------------tgccatgcggcgcctggc------------
A0A3B3E2W4_BCL2L1-      ----------------tggatgccatcaaatccacccttaa---------
A0A3B3DHA1_BCL2L1-      ga-----cgacgaacatggacgcagtgaag-----------------gag
A0A3B3CEX1_MCL1-01      gacccaccgataaaccaggacaccacggaattcctcacgaacttctttag
A0A3B3CEX1_MCL1-02      gacccaccgataaaccaggacaccacggaattcctcacgaacttctttag

A0A3B3C5I4_BCL2L10      ------------------------------ccaggacatggagacgcagt
A0A3B3E2W4_BCL2L1-      ---------------------------------agattcggccaatgagt
A0A3B3DHA1_BCL2L1-      gcgct-------------------------ccgggacacggccaacgagt
A0A3B3CEX1_MCL1-01      gaactatgttggattatctcaatctcgccaccgggaga--gcaaatacat
A0A3B3CEX1_MCL1-02      gaactatgttggattatctcaatctcgccaccgggaga--gcaaatacat
                                                          **    *  *     *

A0A3B3C5I4_BCL2L10      accagccccg--------------------------------cttctcca
A0A3B3E2W4_BCL2L1-      ttgagcgtcg----------------------------------------
A0A3B3DHA1_BCL2L1-      tcgagctgcg-----------gtacgccctg------------------g
A0A3B3CEX1_MCL1-01      atcgacggcgaaaagagtagtgaacgacatgatggataaacatcggttcg
A0A3B3CEX1_MCL1-02      atcgacggcgaaaagagtagtgaacgacatgatggataaacatcggttcg
                             *  **                                        

A0A3B3C5I4_BCL2L10      cgctagctcaggacttcaggaagc---------------actgcgggccg
A0A3B3E2W4_BCL2L1-      -cttcagtcaaggttttagtgatctctctctgcagtttcacatcactcct
A0A3B3DHA1_BCL2L1-      ccttcaacaacctgcacagccagctgc------------acatcacgccc
A0A3B3CEX1_MCL1-01      cctttaatggtatgatcaataggctgtctttggaag---acaatttggac
A0A3B3CEX1_MCL1-02      cctttaatggtatgatcaataggctgtctttggaag---acaatttggac
                           *             *     *               **         

A0A3B3C5I4_BCL2L10      gacctgtgctcc---agcctc------aggaaggtgatggaggagctggt
A0A3B3E2W4_BCL2L1-      gacacggcctaccaaaacttc------aaaagtgtgttggatgagctgtt
A0A3B3DHA1_BCL2L1-      gccacggcctaccagagcttc------gagaacgtgatgaacgagctgtt
A0A3B3CEX1_MCL1-01      gatatgtcatttattagccgcgtagcagagaacatgtttgcggaccgg--
A0A3B3CEX1_MCL1-02      gatatgtcatttattagccgcgtagcagagaacatgtttgcggaccgg--
                        *    *   *     * *  *         *   ** *    ** * *  

A0A3B3C5I4_BCL2L10      gggagatgaacacttgaactgggggagggttgtttccctttttgcattcg
A0A3B3E2W4_BCL2L1-      caaggatg---ggataaactgggggcgtgttgtgggtttgtttgtctttg
A0A3B3DHA1_BCL2L1-      ccgcgaca---acatcaactgggggcgcatcgtggggctcttcgcgttcg
A0A3B3CEX1_MCL1-01      -------a---ccaccaactggggccgcatcgccagcctgctggccttcg
A0A3B3CEX1_MCL1-02      -------a---ccaccaactggggccgcatcgccagcctgctggccttcg
                                        ********  *  * *      *  * *  ** *

A0A3B3C5I4_BCL2L10      tgggagtgctggcgagacagctgagggagcaaacggacacgaacccgggg
A0A3B3E2W4_BCL2L1-      gtggtgtgctgtgtgttgagtgtgtcgag---aggaatatgagtgagctg
A0A3B3DHA1_BCL2L1-      gcggggcgctgtgcgtcgagtgcgtggag---aaggagatgagccccctg
A0A3B3CEX1_MCL1-01      gggcggcggtgtgtctgcagctgaaggag---aagggcagaggtcactcc
A0A3B3CEX1_MCL1-02      gggcggcggtgtgtctgcagctgaaggag---aagggcagaggtcactcc
                          *  * * **       **      ***   * *   *           

A0A3B3C5I4_BCL2L10      ctggacctcgggcgggaagcggcacccggacctgtgagctgccaggcgct
A0A3B3E2W4_BCL2L1-      gtctcccg-cattgctgaatgg----------------------------
A0A3B3DHA1_BCL2L1-      gtggacag-gattgtggagtgg----------------------------
A0A3B3CEX1_MCL1-01      gtggacct-ggtcagtcaggag----------------------------
A0A3B3CEX1_MCL1-02      gtggacct-ggtcagtcaggag----------------------------
                         *   *           *   *                            

A0A3B3C5I4_BCL2L10      ggcagaaactgtagctgatttcctgggaggagacaagaaagagtggatgc
A0A3B3E2W4_BCL2L1-      ----------atgaccatgtacctagacgagcaaataagtccatggatcc
A0A3B3DHA1_BCL2L1-      ----------atgaccgtctacctggacaaccacatccagccgtggatcc
A0A3B3CEX1_MCL1-01      ----------atctgcacgtacctg-----ctgcgt-gagcagcgggact
A0A3B3CEX1_MCL1-02      ----------atctgcacgtacctg-----ctgcgt-gagcagcgggact
                                   *       * ***                    **    

A0A3B3C5I4_BCL2L10      ta------gaaaatgatggatgggaaggcttctgtaagttctccaga---
A0A3B3E2W4_BCL2L1-      ac------agtcaaggaggatgggattgctttgcacagctgtatgggcag
A0A3B3DHA1_BCL2L1-      ag------agccaaggcggatgggagcgttttgctgaaatctttgggcag
A0A3B3CEX1_MCL1-01      ggctgatcaacaacaactcatgggatggtttcgtagagttcttt------
A0A3B3CEX1_MCL1-02      ggctgatcaacaacaactcatgggatggtttcgtagagttcttt------
                                    *      ******  * **     *  * *        

A0A3B3C5I4_BCL2L10      ------acag--ccagagaggtgag---ccaggactcgtccatgaagacg
A0A3B3E2W4_BCL2L1-      gatggcgctg--cagaagcgagaagatttcaagagacgctgaaaaagtgg
A0A3B3DHA1_BCL2L1-      gaggccgcag--ccgaaagcagaaggtctcaggagagcttcaagaagtgg
A0A3B3CEX1_MCL1-01      cacgtcccagacccagaatcaacag---tcaggaacacttt----ggtgg
A0A3B3CEX1_MCL1-02      cacgtcccagacccagaatcaacag---tcaggaacacttt----ggtgg
                               * *  *   *      **    ** **            *  *

A0A3B3C5I4_BCL2L10      gcgctctttgcagcgg---------ccagcgtgggcctggccggactcac
A0A3B3E2W4_BCL2L1-      acgctggtcgcagtggcacttctaaccggact---gctgcttggtttgct
A0A3B3DHA1_BCL2L1-      ctgctggtggggatgacggtggcgaccggcgt---cctggtgggatcctt
A0A3B3CEX1_MCL1-01      ccgtccttggacttg----------caggcgt---t------ggggcttt
A0A3B3CEX1_MCL1-02      ccgtccttggacttg----------caggcgt---t------ggggcttt
                          *    * *    *          *  *  *          **      

A0A3B3C5I4_BCL2L10      cttcctcctgg---------------------------------------
A0A3B3E2W4_BCL2L1-      cattgccaaga---------------------------------------
A0A3B3DHA1_BCL2L1-      catcgcccaga---------------------------------------
A0A3B3CEX1_MCL1-01      actggcccaggtgcaaggtccataccgtatttggcaggatatgacatcat
A0A3B3CEX1_MCL1-02      actggcccaggtgtgtag--------------------------------
                          *   *  *                                        

A0A3B3C5I4_BCL2L10      --------------------------------------------------
A0A3B3E2W4_BCL2L1-      --------------------------------------------------
A0A3B3DHA1_BCL2L1-      --------------------------------------------------
A0A3B3CEX1_MCL1-01      gtcacactaatctatccaaaaataaagttggaagatcaccaagttttgct
A0A3B3CEX1_MCL1-02      --------------------------------------------------

A0A3B3C5I4_BCL2L10      ----tgcgctag---
A0A3B3E2W4_BCL2L1-      ----aacg---gtga
A0A3B3DHA1_BCL2L1-      ----aacgcctgtga
A0A3B3CEX1_MCL1-01      gttgaagggccgtaa
A0A3B3CEX1_MCL1-02      -----------gtga

© 1998-2020Legal notice