Dataset for CDS BAX-like of Organism Anas zonorhyncha

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8B9VTA1_BOK-01       atgg-----------------aagtgctt---------------------
A0A8B9U3X5_BAK1-01      atggtctggggttgggtttctaatttttttttttttttttcggtctctct
A0A8B9U3X5_BAK1-02      atggtctggggttgggtttctaatttttttttttttttttcggtctctct
                        ****                 ** *  **                     

A0A8B9VTA1_BOK-01       -----------------------------------------------cgc
A0A8B9U3X5_BAK1-01      tcttcttttccctcctcctccccggccctgctcgcttccttcccccgcgc
A0A8B9U3X5_BAK1-02      tcttcttttccctcctcctccccggccctgctcgcttccttcccccgcgc
                                                                       ***

A0A8B9VTA1_BOK-01       cgatcctcagtcttc---------------------gctgcagaggtga-
A0A8B9U3X5_BAK1-01      cgcgccgctgcgctccggggaggaggcaggaagggagcggcggggatggg
A0A8B9U3X5_BAK1-02      cgcgccgctgcgctccggggaggaggcaggaagggagcggcggggatggg
                        **  ** * *   **                     ** ** * * **  

A0A8B9VTA1_BOK-01       ---------tggaggtgttcgacaggtctcccactga-------------
A0A8B9U3X5_BAK1-01      gcagctccccggagggatgcgttagggctccccgggaccccccccggccc
A0A8B9U3X5_BAK1-02      gcagctccccggagggatgcgttagggctccccgggaccccccccggccc
                                  *****  * **  *** *****   **             

A0A8B9VTA1_BOK-01       ------------caaggagcttgtgtcccaagcta---------aggctc
A0A8B9U3X5_BAK1-01      ccctggaccccgccgggagccggta----aagctgatcctccccagcatc
A0A8B9U3X5_BAK1-02      ccctggaccccgccgggagccggta----aagctgatcctccccagcatc
                                    *  *****  **     *****          **  **

A0A8B9VTA1_BOK-01       tctgc----------agagactacataaattcgaggctggttcgagca--
A0A8B9U3X5_BAK1-01      tctgcgatggcctcagggaacgacggagacccaccgagggcccacggacg
A0A8B9U3X5_BAK1-02      tctgcgatggcctcagggaacgacggagacccaccgagggcccacggacg
                        *****           *  ** **  * *  *   *  **  *  * *  

A0A8B9VTA1_BOK-01       ----ggtgtcagctggagcaaacc------cgagtgcaatgcg------c
A0A8B9U3X5_BAK1-01      ccggggcagcaatgggcgcagactgtcacaagagctcaattcagaagacc
A0A8B9U3X5_BAK1-02      ccggggcagcaatgggcgcagactgtcacaagagctcaattcagaagacc
                            **   **   ** *** **        ***  **** *       *

A0A8B9VTA1_BOK-01       cggtgcctggcgggaagctggccgaggtgtc---------caccatc--c
A0A8B9U3X5_BAK1-01      aggtggct--caggaaaccga-ggaggtgtttcggagctacgccttctac
A0A8B9U3X5_BAK1-02      aggtggct--caggaaaccga-ggaggtgtttcggagctacgccttctac
                         **** **  * **** * *   *******          * ** **  *

A0A8B9VTA1_BOK-01       tgctgcggctgggagat------gagctggaata------cattcgcccc
A0A8B9U3X5_BAK1-01      cgctaccaacaggagagagaagagagcggggaagaagtgcccttggaccc
A0A8B9U3X5_BAK1-02      cgctaccaacaggagagagaagagagcggggaagaagtgcccttggaccc
                         *** *     *****       **** ** *        * ** * ***

A0A8B9VTA1_BOK-01       aacgtctaccggaacatcgcccgccagctgaacatctcgctgcactcgga
A0A8B9U3X5_BAK1-01      ggagattgcggagat--------ccagcaagacct-gggcagtaccggga
A0A8B9U3X5_BAK1-02      ggagattgcggagat--------ccagcaagacct-gggcagtaccggga
                           *  * * *  *         *****   ** *   ** * **  ***

A0A8B9VTA1_BOK-01       gac-ggtggtgacggacgccttcctggctgtagccg--------------
A0A8B9U3X5_BAK1-01      gcctggtgggga--ggcg----cctggccatcatcggcgatgacattaac
A0A8B9U3X5_BAK1-02      gcctggtgggga--ggcg----cctggccatcatcggcgatgacattaac
                        * * ***** **  * **    ******  *   **              

A0A8B9VTA1_BOK-01       -----------cgcagattttcaccgcaggcataa---------------
A0A8B9U3X5_BAK1-01      aagcggtacgacgctgagtttcgctacatgctgaaatccttgcagctcac
A0A8B9U3X5_BAK1-02      aagcggtacgacgctgagtttcgctacatgctgaaatccttgcagctcac
                                   *** ** **** *  ** **  **               

A0A8B9VTA1_BOK-01       cgtgggg--------------------caaggtggtgtc-------tctc
A0A8B9U3X5_BAK1-01      caaggagaatgcctacgattacttcatcaagattgcctccagcctgtttg
A0A8B9U3X5_BAK1-02      caaggagaatgcctacgattacttcatcaagattgcctccagcctgtttg
                        *  ** *                    **** * *  **       * * 

A0A8B9VTA1_BOK-01       tacgcggtggcagc-ggggctgg----------cggtggactgcg--tgc
A0A8B9U3X5_BAK1-01      aaagcggcattaactggggccgggtgatcgcgctgctgggcttcggctac
A0A8B9U3X5_BAK1-02      aaagcggcattaactggggccgggtgatcgcgctgctgggcttcggctac
                         * ****    * * ***** **           * *** ** **  * *

A0A8B9VTA1_BOK-01       ggcac------------------gcacagc----cagccatggtgcacac
A0A8B9U3X5_BAK1-01      tgcatggccatccacgtctaccagcacggcataacaggcttcctccgccg
A0A8B9U3X5_BAK1-02      tgcatggccatccacgtctaccagcacggcataacaggcttcctccgccg
                         ***                   **** **    *** * *  * * *  

A0A8B9VTA1_BOK-01       catcgtcgactgcctgggagagttcgt-ccgcaagaccttggtgacc--t
A0A8B9U3X5_BAK1-01      catcgcccgctacgtgacggagttcatgctgcgcaaccgcatcgcccagt
A0A8B9U3X5_BAK1-02      catcgcccgctacgtgacggagttcatgctgcgcaaccgcatcgcccagt
                        ***** *  ** * **   ****** * * **   ***     * **  *

A0A8B9VTA1_BOK-01       ggctgaaaaggcgaggaggctgggca-------gacatcacgaagtgcgt
A0A8B9U3X5_BAK1-01      ggatcgcccagcagggaggatgggtg-------------gctgcactcga
A0A8B9U3X5_BAK1-02      ggatcgcccagcagggaggatgggtgagccaggggggtcacggcttgtgc
                        ** *      **  ***** ****                *       * 

A0A8B9VTA1_BOK-01       t--------------------gtgaatactgaccccagccttc--gctcc
A0A8B9U3X5_BAK1-01      tctggacaatgtttacatgaagtacatgctgg---cggt------ggtgg
A0A8B9U3X5_BAK1-02      cctgggggacctggggggcaaggggaggctga---tgggctccgaggtgc
                                             *   *  ***      *       * *  

A0A8B9VTA1_BOK-01       cactggctcgtggctgctgtttgcagctttggg--cacttcctcaaggcg
A0A8B9U3X5_BAK1-01      ccctgg--tgatggtggggcatttagtggtgactataaggcttgaaactg
A0A8B9U3X5_BAK1-02      agctga--ggttggtggggccggcagcgtgggc---agagcaggaggccg
                          ***    *  * **  *     **    *     *   *   *    *

A0A8B9VTA1_BOK-01       atct------------------tcttcgtgctgctgcctgagagatga
A0A8B9U3X5_BAK1-01      ------------------------tgactggccctgtctga-------
A0A8B9U3X5_BAK1-02      gcccaggcagggtgcaggcaggtctaacgccccctg-ctaa-------
                                                *        *** ** *       

© 1998-2023Legal notice