Dataset for CDS BAX-like of Organism Amazona collaria

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8B9IV47_BOK-01       atg-----------------------------------------------
A0A8B9FI91_BAK1-01      atggcctggccagtctgggtggtggatatagtggggcggtgggacagggt
A0A8B9FI91_BAK1-02      atg-----------------------------------------------
                        ***                                               

A0A8B9IV47_BOK-01       ----------------------tggaggtctcccactgacaaggagcttg
A0A8B9FI91_BAK1-01      tttagctgcgaagctcacgtacctgggctttgcacctcatttagtgcctg
A0A8B9FI91_BAK1-02      ---------------------------------cccttattgag------
                                                           ** *    *      

A0A8B9IV47_BOK-01       tgtccc--------------------aggccaaggctct-----------
A0A8B9FI91_BAK1-01      tgaatctctgtcccgcatggtggcacagccaaaggagcagggatctgatc
A0A8B9FI91_BAK1-02      --------------------------aggtaaaagcgca-----------
                                                  **   ** *  *            

A0A8B9IV47_BOK-01       --------------ctgcagagactacat--------------caattcc
A0A8B9FI91_BAK1-01      cctccacaccatttctgtccactgcaaattttgcctcatgaaagagaccc
A0A8B9FI91_BAK1-02      --------------ctgccgagcacaaag---------------------
                                      ***   *    * *                      

A0A8B9IV47_BOK-01       aggctaa---------ttcgagcaggtgtcagctggagcaaacctgagta
A0A8B9FI91_BAK1-01      agggaagagccgtgcttccgaccaggtggccgaggagacgga--------
A0A8B9FI91_BAK1-02      -------------------gaccaggtggccgaggagacgga--------
                                           ** ****** * *  *   *  *        

A0A8B9IV47_BOK-01       caatgcaccagtgcctggcggtaagctagccgaggtgtccgccatactgc
A0A8B9FI91_BAK1-01      ----------------ggaggtg---tttcggagctatgccttctaccgc
A0A8B9FI91_BAK1-02      ----------------ggaggtg---tttcggagctatgccttctaccgc
                                        ** ***    *  * *** * * *    *** **

A0A8B9IV47_BOK-01       tgcgactggggga-------------------------------------
A0A8B9FI91_BAK1-01      tacgagcaggagagagagga------------------------------
A0A8B9FI91_BAK1-02      tacgagcaggagagagaggagcgaggggaggaggtgcccgtggaccagga
                        * ***   ** **                                     

A0A8B9IV47_BOK-01       -----------------------------------tgagc----tggaat
A0A8B9FI91_BAK1-01      ------------------------------caccgggagcctggtgggac
A0A8B9FI91_BAK1-02      gatcatggacatcgaggaggagctgggcagcaccgggagcctggtgggac
                                                            ****    *** * 

A0A8B9IV47_BOK-01       a------------cattcgccccaatgtctac---cggaatatcgc----
A0A8B9FI91_BAK1-01      agcgcttggccatcatcggcgacgacatcaacaagcggtacgacgcggag
A0A8B9FI91_BAK1-02      agcgcttggccatcatcggcgacgacatcaacaagcggtacgacgcggag
                        *            ***  **  * *  ** **   *** *   ***    

A0A8B9IV47_BOK-01       --ccgccaactgaacatctccctgcactc------ggagacggtggtgac
A0A8B9FI91_BAK1-01      ttccgctacctgctcaagtccctgcagcccaccaaggaga--acgcctac
A0A8B9FI91_BAK1-02      ttccgctacctgctcaagtccctgcagcccaccaaggaga--acgcctac
                          **** * ***  **  ********  *      *****    *   **

A0A8B9IV47_BOK-01       agatgccttcctggcagtggcagcacagatt-ttcactgcaggcataacg
A0A8B9FI91_BAK1-01      gagtgcttcacccg-agtagcctc-cagcttgttcgagagcggcattaac
A0A8B9FI91_BAK1-02      gagtgcttcacccg-agtagcctc-cagcttgttcgagagcggcattaac
                           *** *  *  * *** **  * *** ** ***      ***** *  

A0A8B9IV47_BOK-01       tggggcaaggtggtgtctct-ctatgctgtggcagctgggctgtcagtgg
A0A8B9FI91_BAK1-01      tggggccgggtgatcgcgctgctgggctttggctaccgcatggccatcca
A0A8B9FI91_BAK1-02      tggggccgggtgatcgcgctgctgggctttggctaccgcatggccatcca
                        ******  **** *  * ** **  *** ****  * *    * **    

A0A8B9IV47_BOK-01       actgtgtgcggcacgcacagccagccatggttcacactatcgtagactgc
A0A8B9FI91_BAK1-01      cgtgtaccagcaaggcaggaccggct-tcctgcgctggatcgcccactgc
A0A8B9FI91_BAK1-02      cgtgtaccagcaaggcaggaccggct-tcctgcgctggatcgcccactgc
                          ***    *  * ***   ** **  *  * * *   ****   *****

A0A8B9IV47_BOK-01       ctgggagagtttgtccgcaagaccttggtaacatggctga------aaag
A0A8B9FI91_BAK1-01      gtcgtggagttcatgctccggaaccgcatcgcccggtggatcgcccaaca
A0A8B9FI91_BAK1-02      gtcgtggagttcatgctccggaaccgcatcgcccggtggatcgcccaaca
                         * *  *****  * * *  ** *    *  *  **  **      **  

A0A8B9IV47_BOK-01       gagaggaggctgggcagacatcacaaaatgcgtggtgaacactgacccca
A0A8B9FI91_BAK1-01      gggagga---tgggcggct-------------------gcactcgatctg
A0A8B9FI91_BAK1-02      gggagga---tgggcggct-------------------gcactcgatctg
                        * *****   ***** *                      ****    *  

A0A8B9IV47_BOK-01       gcctccgctcccact-ggctcgtgtctgctgtttgcagctttggtcactt
A0A8B9FI91_BAK1-01      gacaatgtttccatgaagtacatg-ctggtgatggtggccctggtca---
A0A8B9FI91_BAK1-02      gacaatgtttccatgaagtacatg-ctggtgatggtggccctggtca---
                        * *   * * ***    *  * ** *** ** * *  **  ******   

A0A8B9IV47_BOK-01       cctcaaggctatcttcttcgtcctgctgcct----gagagatga
A0A8B9FI91_BAK1-01      ---tggtggtacatttagtggtacgccgcttcttcaagccctaa
A0A8B9FI91_BAK1-02      ---tggtggtacatttagtggtacgccgcttcttcaagccctaa
                               * **  **    *    ** ** *     **   * *

© 1998-2023Legal notice