Dataset for CDS BCL2L2 of organism Rattus norvegicus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

O88996_BCL2L2-01      --------------------------------------------------
Q7TS60_BCL2L2-01      atgtccctttttggtctctgtcaatatttttcatatatttatgtcagtct

O88996_BCL2L2-01      ----------------------------atggcgaccccagcctcaaccc
Q7TS60_BCL2L2-01      gtcatccttgcccctttcagccgcccggatggcgaccccagcctcaaccc

O88996_BCL2L2-01      cagacacacgggctctagtggctgactttgtaggctataagctgaggcag
Q7TS60_BCL2L2-01      cagacacacgggctctagtggctgactttgtaggctataagctgaggcag

O88996_BCL2L2-01      aagggttatgtctgtggagctggccctggggaaggcccagcagccgaccc
Q7TS60_BCL2L2-01      aagggttatgtctgtggagctggccctggggaaggcccagcagccgaccc

O88996_BCL2L2-01      gctgcaccaagccatgcgggcagctggagacgagtttgagacccgcttcc
Q7TS60_BCL2L2-01      gctgcaccaagccatgcgggcagctggagacgagtttgagacccgcttcc

O88996_BCL2L2-01      ggcgcaccttctctgacctggccgctcagctacacgtgaccccaggctca
Q7TS60_BCL2L2-01      ggcgcaccttctctgacctggccgctcagctacacgtgaccccaggctca

O88996_BCL2L2-01      gcccagcaacgcttcacccaggtttccgacgaacttttccaagggggccc
Q7TS60_BCL2L2-01      gcccagcaacgcttcacccaggtttccgacgaacttttccaagggggccc

O88996_BCL2L2-01      caactggggccgtcttgtggcattctttgtctttggggctgccctgtgtg
Q7TS60_BCL2L2-01      caactggggccgtcttgtggcattctttgtctttggggctgccctgtgtg

O88996_BCL2L2-01      ctgagagtgtcaacaaagaaatggagccattggtgggacaagtgcaggat
Q7TS60_BCL2L2-01      ctgagagtgtcaacaaagaaatggagccattggtgggacaagtgcaggat

O88996_BCL2L2-01      tggatggtgacctacctggagacacgcttggctgactggatccacagcag
Q7TS60_BCL2L2-01      tggatggtgacctacctggagacacgcttggctgactggatccacagcag

O88996_BCL2L2-01      tgggggctgggcggagttcacagctctatacggggacggggccctggagg
Q7TS60_BCL2L2-01      tgggggctgggcggagttcacagctctatacggggacggggccctggagg

O88996_BCL2L2-01      aggcacggcgtctgcgggaggggaactgggcatcagtgaggacagtgctg
Q7TS60_BCL2L2-01      aggcacggcgtctgcgggaggggaactgggcatcagtgaggacagtgctg

O88996_BCL2L2-01      acgggggctgtggcactgggggccctggtaactgtaggggccttttttgc
Q7TS60_BCL2L2-01      acgggggctgtggcactgggggccctggtaactgtaggggccttttttgc

O88996_BCL2L2-01      tagcaagtga
Q7TS60_BCL2L2-01      tagcaagtga

© 1998-2020Legal notice