Dataset for CDS BCL2A1 of organism Cercocebus atys

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K5KHH8_BCL2A1-      atgacagactgtgaatttggatatatttacaggctagctcaggactattt
A0A2K5KHH8_BCL2A1-      atgacagactgtgaatttggatatatttacaggctagctcaggactattt
                        **************************************************

A0A2K5KHH8_BCL2A1-      gcagtacgttctgcagataccacaacctggatcgggtccaagcaaaacgt
A0A2K5KHH8_BCL2A1-      gcagtacgttctgcagataccacaacctggatcgggtccaagcaaaacgt
                        **************************************************

A0A2K5KHH8_BCL2A1-      ccagagtgctacaaaaggttgcattctcagtccaaaaagaagtggaaaag
A0A2K5KHH8_BCL2A1-      ccagagtgctacaaaaggttgcattctcagtccaaaaagaagtggaaaag
                        **************************************************

A0A2K5KHH8_BCL2A1-      aatctgaagccatgcttggacaatgttaatgttgcatccatagacactgc
A0A2K5KHH8_BCL2A1-      aatctgaagccatgcttggacaatgttaatgttgcatccatagacactgc
                        **************************************************

A0A2K5KHH8_BCL2A1-      cagaacactattcaatcaagtgatggaaaaggaatttgaagatggcatca
A0A2K5KHH8_BCL2A1-      cagaacactattcaatcaagtgatggaaaaggaatttgaagatggcatca
                        **************************************************

A0A2K5KHH8_BCL2A1-      ttaactggggaagaattgtaaccatatttgcatttgaaggtattctcatc
A0A2K5KHH8_BCL2A1-      ttaactggggaagaattgtaaccatatttgcatttgaaggtattctcatc
                        **************************************************

A0A2K5KHH8_BCL2A1-      aagaaacttctacgacagcgaattgccccggatgtggatacttataagga
A0A2K5KHH8_BCL2A1-      aagaaacttctacgacagcgaattgccccggatgtggatacttataagga
                        **************************************************

A0A2K5KHH8_BCL2A1-      gatttcgtattttgttgctgagttcataatgaataacacaggagaatgga
A0A2K5KHH8_BCL2A1-      gatttcgtattttgttgctgagttcataatgaataacacaggagaatgga
                        **************************************************

A0A2K5KHH8_BCL2A1-      taaggcaaaacggaggctgggaaaatggctttgtaaagaagcttgagcct
A0A2K5KHH8_BCL2A1-      taaggcaaaacggaggctgggaaaatggctttgtaaagaagtttgaacct
                        ***************************************** **** ***

A0A2K5KHH8_BCL2A1-      aaatctggctggatgacttttctagaagttacaggaaagatctgtgaaat
A0A2K5KHH8_BCL2A1-      aaatctggctggatgacttttctagaagttacaggaaagatctgtgaaat
                        **************************************************

A0A2K5KHH8_BCL2A1-      gctctctcttctgaagcaatactgttga
A0A2K5KHH8_BCL2A1-      gctatctctcctgaagcaatactgttga
                        *** ***** ******************

© 1998-2020Legal notice