Dataset for CDS BCL2L2 of organism Colobus angolensis palliatus

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2K5HEJ9_BCL2L2-      atggcgaccccagcctcggccccagacacacgggctctggtggcagactt
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      atggcgaccccagcctcggccccagacacacgggctctggtggcagactt

A0A2K5HEJ9_BCL2L2-      tgtaggttataagctgaggcagaagggttatgtctgtggagctggccccg
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      tgtaggttataagctgaggcagaagggttatgtctgtggagctggccccg

A0A2K5HEJ9_BCL2L2-      gggagggcccagcagctgacccgctgcaccaagccatgcgggcagctgga
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      gggagggcccagcagctgacccgctgcaccaagccatgcgggcagctgga

A0A2K5HEJ9_BCL2L2-      gatgagttcgagacccgcttccggcgcaccttctctgatctggcggctca
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      gatgagttcgagacccgcttccggcgcaccttctctgatctggcggctca

A0A2K5HEJ9_BCL2L2-      gctgcatgtgaccccaggctcagcgcagcaacgcttcacccaggtctctg
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      gctgcatgtgaccccaggctcagcgcagcaacgcttcacccaggtctctg

A0A2K5HEJ9_BCL2L2-      atgaacttttccaagggggccccaactggggccgccttgtagccttcttt
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      atgaacttttccaagggggccccaactggggccgccttgtagccttcttt

A0A2K5HEJ9_BCL2L2-      gtctttggggctgcactgtgtgctgagagtgtcaacaaggagatggaacc
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      gtctttggggctgcactgtgtgctgagagtgtcaacaaggagatggaacc

A0A2K5HEJ9_BCL2L2-      actggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      actggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc

A0A2K5HEJ9_BCL2L2-      tggctgactggatccacagcagtgggggctgggcg---------------
A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      tggctgactggatccacagcagtgggggctgggagctggaagctatcaaa

A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      ---------------atggaggaagaagctgagaagctaaaggagctaca
A0A2K5HEJ9_BCL2L2-      gctcgagtcagggagatggaggaagaagctgagaagctaaaggagctaca

A0A2K5HEJ9_BCL2L2-      ---------------------------gagttcacagctctatacgggga
A0A2K5HEJ9_BCL2L2-      gaacgaggtagagaagcagatgaatatgagtccac--ctccaggcaatgc
A0A2K5HEJ9_BCL2L2-      gaacgaggtagagaagcagatgaatatgagtccac--ctccaggcaatgc
                                                   **** ***  *** *  *   * 

A0A2K5HEJ9_BCL2L2-      cgg------------ggccctggaggaggcg-cggcgtctg---------
A0A2K5HEJ9_BCL2L2-      tggcccagtgatcatgtccattgaggagaagatggaggctgatgcccgtt
A0A2K5HEJ9_BCL2L2-      tggcccagtgatcatgtccattgaggagaagatggaggctgatgcccgtt
                         **            * ** * ******  *  ** * ***         

A0A2K5HEJ9_BCL2L2-      ---------------------------------cgggaggggaactgg--
A0A2K5HEJ9_BCL2L2-      ccatctatgttggcaatgtggactatggtgcaacagcagaagagctggaa
A0A2K5HEJ9_BCL2L2-      ccatctatgttggcaatgtggactatggtgcaacagcagaagagctggaa
                                                         * * **  ** ****  

A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      gctcactttcatggctgtggatcagtcaaccgtgttaccatactctgtga
A0A2K5HEJ9_BCL2L2-      gctcactttcatggctgtggatcagtcaaccgtgttaccatactctgtga

A0A2K5HEJ9_BCL2L2-      --------------------------------------------------
A0A2K5HEJ9_BCL2L2-      caaatttagtggccatcccaaagggtttgcgtatatagagttctcagaca
A0A2K5HEJ9_BCL2L2-      caaatttagtggccatcccaaagggtttgcgtatatagagttctcagaca

A0A2K5HEJ9_BCL2L2-      --gcatcagtgaggac----------------------------------
A0A2K5HEJ9_BCL2L2-      aagagtcagtgaggacgtccttggccttagatgagtccctatttagagga
A0A2K5HEJ9_BCL2L2-      aagagtcagtgaggacgtccttggccttagatgagtccctatttagagga
                          *  ***********                                  

A0A2K5HEJ9_BCL2L2-      -----------agtg-----------------------------------
A0A2K5HEJ9_BCL2L2-      aggcaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcac
A0A2K5HEJ9_BCL2L2-      aggcaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcac

A0A2K5HEJ9_BCL2L2-      --ctgacggggg--------------------------------------
A0A2K5HEJ9_BCL2L2-      aacagaccggggttttccacgagcccgctaccgcgcccggaccaccaact
A0A2K5HEJ9_BCL2L2-      aacagaccggggttttccacgagcccgctaccgcgcccggaccaccaact
                          * *** ****                                      

A0A2K5HEJ9_BCL2L2-      -------------------------ccgtggc----actgggggccctg-
A0A2K5HEJ9_BCL2L2-      acaacagttcccgctctcgattctacagtggttttaacagcaggccccgg
A0A2K5HEJ9_BCL2L2-      acaacagttcccgctctcgattctacagtggttttaacagcaggccccgg
                                                 * ****     ** *  ***** * 

A0A2K5HEJ9_BCL2L2-      ----gtaactgtaggggcc--------------------ttttttgctag
A0A2K5HEJ9_BCL2L2-      ggtcgcgtctacaggggccgggctagagcgacatcatggtattcccctta
A0A2K5HEJ9_BCL2L2-      ggtcgcgtctacaggggccgggctagagcgacatcatggtattcccctta
                            *   **  *******                    * **   **  

A0A2K5HEJ9_BCL2L2-      caagtga
A0A2K5HEJ9_BCL2L2-      c---taa
A0A2K5HEJ9_BCL2L2-      c---taa
                        *   * *

© 1998-2022Legal notice