Dataset for CDS Unclassified of Organism Kryptolebias marmoratus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A3Q3AD95_uncBCLWAV-01 Putative BCL2 homolog found in water-living anamniote vertebrates gene OS=[Eukaryota] Kryptolebias marmoratus (length=663 residues).
atgtgtcagtcggaggtgccgggggccagactgggcctgaacagtcctgatccattggtaagagaggcttttctgatggc
tcatgactacatagactatgtcactaaaggggcaggtggaactgtgggtcctgcccctacagcctgcgccgcagccctgc
gccacgctggagatgagcttctcactcgcttccccatcttcttcaggcgctggcctcgcatcttccaggacgtgacagaa
aatacggcatgccccgtgctcattagcatcctggatgagcacttctttccccctgtccccaaagggcgacagagggactt
gtcctggagcgccgtgctgtcagtctatgtgctggctggccagatggctctgcactgcaacgagagaggcatggtggcag
tcctgcctcagctcaaagagagcgtgggagtatatgtgaaaagggttatttgtcctgatataagagacaaaggaggatgg
gaaggttttgtgtcacactttggaaagaagcagaacctggagggtcaggtgaaaatggtgtgcttctggacactgatagc
actgactgtctgcatcctcagccactttttttggagaaggatggcttggccaacactcccacctactggtttcaagtatg
gaagaggcacccaacacatctga
© 1998-2023Legal notice