Dataset for CDS BCL2L1 of organism Acanthochromis polyacanthus

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3Q1EVP6_BCL2L1-      --------------------------------------------------
A0A3Q1FR00_BCL2L1-      --------------------------------------------------
A0A3Q1FR00_BCL2L1-      atgttccgacggcacgtgaaggcgtcatattacgtaatagggaggcaggg

A0A3Q1EVP6_BCL2L1-      --------------------------------------------------
A0A3Q1FR00_BCL2L1-      --------------------------------------------------
A0A3Q1FR00_BCL2L1-      ccgagcggacgtaggaggatacgtgcgagcacacacactcgtgaacacaa

A0A3Q1EVP6_BCL2L1-      --------------------------------------------------
A0A3Q1FR00_BCL2L1-      --------------------------------------------------
A0A3Q1FR00_BCL2L1-      agtggatgtgtgacattcttgtggagcttgacagctttttgtgcgcaccg

A0A3Q1EVP6_BCL2L1-      --------------------------------------------------
A0A3Q1FR00_BCL2L1-      --------------------------------------------------
A0A3Q1FR00_BCL2L1-      agcgacagacggactggagacagcgtcacggagcggaggacagcttcccg

A0A3Q1EVP6_BCL2L1-      --------------------------------------------------
A0A3Q1FR00_BCL2L1-      --------------------------------------------------
A0A3Q1FR00_BCL2L1-      ggaatcccgtgcttttgtttcggttcttgctgggcctgagctggtttgtc

A0A3Q1EVP6_BCL2L1-      --------------------------------------------------
A0A3Q1FR00_BCL2L1-      --------------------------------------------------
A0A3Q1FR00_BCL2L1-      agccttgtgtaggtttggttttcacccccgagcgtcctgtggatatcagc

A0A3Q1EVP6_BCL2L1-      --------------------------------------------------
A0A3Q1FR00_BCL2L1-      --------------------------------------------------
A0A3Q1FR00_BCL2L1-      ggaccatggtggtctgagcagagggcagcaggaaggcagcctggcacagt

A0A3Q1EVP6_BCL2L1-      --------------------------------------------------
A0A3Q1FR00_BCL2L1-      --------------------------------------------------
A0A3Q1FR00_BCL2L1-      gtgtgttcactctaacgcagcgagacggaccagagccacgaggacggaaa

A0A3Q1EVP6_BCL2L1-      -----------------atgtcgtgcagtaacagagagctggtggagttc
A0A3Q1FR00_BCL2L1-      -----------------atgtc--tcag-aacagagaactggtggttttc
A0A3Q1FR00_BCL2L1-      acacattggcacgcaacatgtc--tcag-aacagagaactggtggttttc
                                         *****   *** ******** *******  ***

A0A3Q1EVP6_BCL2L1-      tttataagctacaagctgtctcaaaggaactatccgatgtctctgctgag
A0A3Q1FR00_BCL2L1-      tacataaagtataaactgtcccagagaaactatcc----cctc------a
A0A3Q1FR00_BCL2L1-      tacataaagtataaactgtcccagagaaactatcc----cctc------a
                        *  ****  ** ** ***** ** ** ********     ***       

A0A3Q1EVP6_BCL2L1-      gccagaggatgctggagga----------aggactgatggggacaaggcc
A0A3Q1FR00_BCL2L1-      accacatggtgctgaacgaggctcccaacaggactgatgggggggaggcc
A0A3Q1FR00_BCL2L1-      accacatggtgctgaacgaggctcccaacaggactgatgggggggaggcc
                         *** * * ***** * **          *************   *****

A0A3Q1EVP6_BCL2L1-      -----------agctcagcctccag----------------------taa
A0A3Q1FR00_BCL2L1-      cggctgggagaggaccagcggacagagacacacgccaacgggacttttaa
A0A3Q1FR00_BCL2L1-      cggctgggagaggaccagcggacagagacacacgccaacgggacttttaa
                                    *  ****   ***                      ***

A0A3Q1EVP6_BCL2L1-      cggc---------------------------------ttgctggtgaaca
A0A3Q1FR00_BCL2L1-      cggcacgagtcccgggacccccccgccgtccccgcggcggctggcg-tcg
A0A3Q1FR00_BCL2L1-      cggcacgagtcccgggacccccccgccgtccccgcggcggctggcg-tcg
                        ****                                   ***** *  * 

A0A3Q1EVP6_BCL2L1-      acagagacggcatagaggctgtaaaatccacccttaaggatgcggcagat
A0A3Q1FR00_BCL2L1-      acggcgac--catggacgcagtgaaggaggccctccgggacacggccaac
A0A3Q1FR00_BCL2L1-      acggcgac--catggacgcagtgaaggaggccctccgggacacggccaac
                        ** * ***  *** ** ** ** **     ****   ***  ****  * 

A0A3Q1EVP6_BCL2L1-      gaatttgaacttctcttcacgcaaactttcagtgacctgtcttcgcagat
A0A3Q1FR00_BCL2L1-      gagttcgagctgcggtacgcccgcgccttcagcgacctgcacagccagct
A0A3Q1FR00_BCL2L1-      gagttcgagctgcggtacgcccgcgccttcagcgacctgcacagccagct
                        ** ** ** ** *  * * * *   * ***** ******      *** *

A0A3Q1EVP6_BCL2L1-      tgacatcacccctgaaacggcctaccacagctttaagagtgtgatggatg
A0A3Q1FR00_BCL2L1-      gcacatcacgcccgccaccgcctaccagagcttcgagaacgtcatggacg
A0A3Q1FR00_BCL2L1-      gcacatcacgcccgccaccgcctaccagagcttcgagaacgtcatggacg
                          ******* ** *  ** ******** *****  ***  ** ***** *

A0A3Q1EVP6_BCL2L1-      aggtgttcaaggatggggtcaactggggacgtatagtgggcctgttttgc
A0A3Q1FR00_BCL2L1-      aggtgttccgggacggcgtcaactggggccgcatcgtggggctgttcgcg
A0A3Q1FR00_BCL2L1-      aggtgttccgggacggcgtcaactggggccgcatcgtggggctgttcgcg
                        ********  *** ** *********** ** ** ***** *****    

A0A3Q1EVP6_BCL2L1-      tttggcggtgtactgtgtgtggaatgcgtagagaagaatatgagtgagct
A0A3Q1FR00_BCL2L1-      ttcggcggggcgctgtgcgtcgagtgcgtggaaaaggagatgagccccct
A0A3Q1FR00_BCL2L1-      ttcggcggggcgctgtgcgtcgagtgcgtggaaaaggagatgagccccct
                        ** ***** *  ***** ** ** ***** ** *** * *****    **

A0A3Q1EVP6_BCL2L1-      ggttccccgcatcgctgactggatgaccatgtacctggatgagcacatca
A0A3Q1FR00_BCL2L1-      ggtgggcaggatcgtagagtggatgaccgtctacctggacaaccacattc
A0A3Q1FR00_BCL2L1-      ggtgggcaggatcgtagagtggatgaccgtctacctggacaaccacattc
                        ***   * * ****  ** ********* * ********  * *****  

A0A3Q1EVP6_BCL2L1-      gtccctggatccagagccaaggagactgggagtgctttgctgagattttt
A0A3Q1FR00_BCL2L1-      aggactggatccagggccagggaggatgggagcgttttgctgagatcttc
A0A3Q1FR00_BCL2L1-      aggactggatccagggccagggaggatgggagcgttttgctgagatcttc
                            ********** **** ****  ****** * *********** ** 

A0A3Q1EVP6_BCL2L1-      gggcagaacgccgctgcagaagcacggaggtctcgggatactctgaagcg
A0A3Q1FR00_BCL2L1-      ggtcaggacgcggcggccgagagcaggaggtctcaggagagcttcaagaa
A0A3Q1FR00_BCL2L1-      ggtcaggacgcggcggccgagagcaggaggtctcaggagagcttcaagaa
                        ** *** **** ** ** **     ********* *** *   * ***  

A0A3Q1EVP6_BCL2L1-      atggctgctagccggaggggtgctgctaatgggagtgctggctggtgtac
A0A3Q1FR00_BCL2L1-      gtggctgctggtggggatgacggtggtgacgggggtggtggtggggtcgc
A0A3Q1FR00_BCL2L1-      gtggctgctggtggggatgacggtggtgacgggggtggtggtggggtcgc
                         ******** *  **   *  * ** * * *** *** ***  **    *

A0A3Q1EVP6_BCL2L1-      tcattgctaagaaaca---gtga
A0A3Q1FR00_BCL2L1-      tcatcgcccagaaacgcctgtga
A0A3Q1FR00_BCL2L1-      tcatcgcccagaaacgcctgtga
                        **** **  ******    ****

© 1998-2022Legal notice