Dataset for CDS BCL-2-like of organism Gorilla gorilla gorilla

[Download (right click)] [Edit] [Sequences] [Repertoires]

12 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2I2YJV4_BCL2A1-      atgacagact-----gtgaatttggatatatttacagg------------
A0A2I2YJV4_BCL2A1-      atgacagact-----gtgaatttggatatatttacagg------------
A0A2I2YJV4_BCL2A1-      atgacagact-----gtgaatttggatatatttacagg------------
A0A2I2YPX6_BCL2L2-      atggcggcggcggcggcggcggcagcagc----agcgggggctgcgggcg
A0A2I2YPX6_BCL2L2-      atggcggcggcggcggcggcggcagcagc----agcgggggctgcgggcg
A0A2I2YPX6_BCL2L2-      atggcgaccccagcctcggccccagacac----a-cgggctctggtggca
A0A2I2YPX6_BCL2L2-      atggcgaccccagcctcggccccagacac----a-cgggctctggtggca
G3QLU6_BCL2L10-01       atggttgaccagtggcgggagcgcaccaccatggccga------------
G3QES9_BCL2-01          atggcgcacg--ctgggagaacagggtacgataaccgagagatagtgatg
A0A2I2YJ87_MCL1-02      atgtttggcc--tcaaaagaa----acgcggtaatcgg------------
A0A2I2YJ87_MCL1-01      atgtttggcc--tcaaaagaa----acgcggtaatcgg------------
A0A2I2YJ87_MCL1-03      atgtttggcc--tcaaaagaa----acgcggtaatcgg------------
                        ***                                 *             

A0A2I2YJV4_BCL2A1-      ------------------ctagctcag-----------------------
A0A2I2YJV4_BCL2A1-      ------------------ctagctcag-----------------------
A0A2I2YJV4_BCL2A1-      ------------------ctagctcag-----------------------
A0A2I2YPX6_BCL2L2-      gtc----ggggctccgggccggggcggcgacgccatcttgtgcccggggc
A0A2I2YPX6_BCL2L2-      gtc----ggggctccgggccggggcggcgacgccatcttgtgcccggggc
A0A2I2YPX6_BCL2L2-      gactttgtaggttataagctgaggcagaagggtta---tgtctgtggagc
A0A2I2YPX6_BCL2L2-      gactttgtaggttataagctgaggcagaagggtta---tgtctgtggagc
G3QLU6_BCL2L10-01       -----------------cccgctgcgggagcgcaccgagcggttgctggc
G3QES9_BCL2-01          aagtacatccattataagctgtcgcagaggggctacg---agtgggatgc
A0A2I2YJ87_MCL1-02      ------actcaacct---ctactgtgggggggc--cg---gcttgggggc
A0A2I2YJ87_MCL1-01      ------actcaacct---ctactgtgggggggc--cg---gcttgggggc
A0A2I2YJ87_MCL1-03      ------actcaacct---ctactgtgggggggc--cg---gcttgggggc
                                          *       *                       

A0A2I2YJV4_BCL2A1-      -gactatctgca-----------gtacgtcctacagataccacaacctgg
A0A2I2YJV4_BCL2A1-      -gactatctgca-----------gtacgtcctacagataccacaacctgg
A0A2I2YJV4_BCL2A1-      -gactatctgca-----------gtacgtcctacagataccacaacctgg
A0A2I2YPX6_BCL2L2-      cggt----ggggaggccggggagggggccccggggggcgcaggggactac
A0A2I2YPX6_BCL2L2-      cggt----ggggaggccggggagggggccccggggggcgcaggggactac
A0A2I2YPX6_BCL2L2-      tggccccggggagggcccagcagctgaccc-----gctgcaccaagccat
A0A2I2YPX6_BCL2L2-      tggccccggggagggcccagcagctgaccc-----gctgcaccaagccat
G3QLU6_BCL2L10-01       cgactacctggg-gta-------ctgcgcccgggaacccggcacccccga
G3QES9_BCL2-01          gggagatgtgggcgcc-------gtgcccccgggggccgcccccgcaccg
A0A2I2YJ87_MCL1-02      cggcagcggcggcgcc-------acccctccggga--------------g
A0A2I2YJ87_MCL1-01      cggcagcggcggcgcc-------acccctccggga--------------g
A0A2I2YJ87_MCL1-03      cggcagcggcggcgcc-------acccctccggga--------------g
                         *                           *                    

A0A2I2YJV4_BCL2A1-      atcag---------------------gtccaagcaaaa------------
A0A2I2YJV4_BCL2A1-      atcag---------------------gtccaagcaaaa------------
A0A2I2YJV4_BCL2A1-      atcag---------------------gtccaagcaaaa------------
A0A2I2YPX6_BCL2L2-      gggaacggcctg----ga--------gtctgag-----------------
A0A2I2YPX6_BCL2L2-      gggaacggcctg----ga--------gtctgag-----------------
A0A2I2YPX6_BCL2L2-      gcgggcagctggagatga--------gttcgagacccg------------
A0A2I2YPX6_BCL2L2-      gcgggcagctggagatga--------gttcgagacccg------------
G3QLU6_BCL2L10-01       gccgacgcc-----------------gtccacgcccga------------
G3QES9_BCL2-01          ggcatcttctc---------------ctcccagcccgg------------
A0A2I2YJ87_MCL1-02      ggcgacttttagctacggagaaggaggcctcggcccggcgagagataggg
A0A2I2YJ87_MCL1-01      ggcgacttttagctacggagaaggaggcctcggcccggcgagagataggg
A0A2I2YJ87_MCL1-03      ggcgactttta---------------------------------------

A0A2I2YJV4_BCL2A1-      --------------------------------------------------
A0A2I2YJV4_BCL2A1-      --------------------------------------------------
A0A2I2YJV4_BCL2A1-      --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
A0A2I2YPX6_BCL2L2-      -------------------------------cttccggcgcaccttctct
A0A2I2YPX6_BCL2L2-      -------------------------------cttccggcgcaccttctct
G3QLU6_BCL2L10-01       -----------------------------ggccgccgtgctgcgctccgc
G3QES9_BCL2-01          ---------------------------------------gcacacgcccc
A0A2I2YJ87_MCL1-02      ggaggggaggccggcgcggtgattggcggaagcgccggcgcaagcccccc
A0A2I2YJ87_MCL1-01      ggaggggaggccggcgcggtgattggcggaagcgccggcgcaagcccccc
A0A2I2YJ87_MCL1-03      --------------------------------------------------

A0A2I2YJV4_BCL2A1-      -----------------------------------cgtccagagtgctac
A0A2I2YJV4_BCL2A1-      -----------------------------------cgtccagagtgctac
A0A2I2YJV4_BCL2A1-      -----------------------------------cgtccagagtgctac
A0A2I2YPX6_BCL2L2-      gaactggagcctgaggagctgctgctggagcccgagccggagcccg----
A0A2I2YPX6_BCL2L2-      gaactggagcctgagga---------------------------------
A0A2I2YPX6_BCL2L2-      gatctggcggctcagctgcatgtg-----------accccaggctc----
A0A2I2YPX6_BCL2L2-      gatctggcggctcagctgcatgtg-----------accccaggctc----
G3QLU6_BCL2L10-01       ggcc---------------------------------gccaggttacggc
G3QES9_BCL2-01          atccagccgc-------------------------atcccgggacc----
A0A2I2YJ87_MCL1-02      gtccaccctc-------------------------acgccagactcccgg
A0A2I2YJ87_MCL1-01      gtccaccctc-------------------------acgccagactcccgg
A0A2I2YJ87_MCL1-03      --------------------------------------------------

A0A2I2YJV4_BCL2A1-      aaa-----------------------------------------------
A0A2I2YJV4_BCL2A1-      aaa-----------------------------------------------
A0A2I2YJV4_BCL2A1-      aaa-----------------------------------------------
A0A2I2YPX6_BCL2L2-      -agcccgaagaggagccgccccggcccc------------------gcgc
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
A0A2I2YPX6_BCL2L2-      -agcccaacaacgcttcacccaggtctccgatgaactttttcaagggggc
A0A2I2YPX6_BCL2L2-      -agcccaacaacgcttcacccaggtctccgatgaactttttcaagggggc
G3QLU6_BCL2L10-01       agattcaccggtccttctt-------ctccgcctacctc--------ggc
G3QES9_BCL2-01          -gggtcgccaggacctcgc-------cgctgcagacccc--------ggc
A0A2I2YJ87_MCL1-02      agggtcgcgcggccgccgcccattggcgccgaggtcccc--------gac
A0A2I2YJ87_MCL1-01      agggtcgcgcggccgccgcccattggcgccgaggtcccc--------gac
A0A2I2YJ87_MCL1-03      --------------------------------------------------

A0A2I2YJV4_BCL2A1-      -----------------------------------------------agg
A0A2I2YJV4_BCL2A1-      -----------------------------------------------agg
A0A2I2YJV4_BCL2A1-      -----------------------------------------------agg
A0A2I2YPX6_BCL2L2-      ccccccgggagctcc----gggccctgggcctggttc----------ggg
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
A0A2I2YPX6_BCL2L2-      cccaactggggccgccttgtagccttctttgtctttg----------ggg
A0A2I2YPX6_BCL2L2-      cccaactggggccgccttgtagccttctttgtctttg----------ggg
G3QLU6_BCL2L10-01       taccccgggaaccgcttcgag-----------ctg--------------g
G3QES9_BCL2-01          tgcccccggcgccgccgcggggc---------ctgcgctca------gcc
A0A2I2YJ87_MCL1-02      -gtcaccgcgacccccgcgaggctgcttttctttgcgcccacccgccgcg
A0A2I2YJ87_MCL1-01      -gtcaccgcgacccccgcgaggctgcttttctttgcgcccacccgccgcg
A0A2I2YJ87_MCL1-03      --------------------------------------------------

A0A2I2YJV4_BCL2A1-      ttgcgttctcagtccaaaaagaag--------------------------
A0A2I2YJV4_BCL2A1-      ttgcgttctcagtccaaaaagaag--------------------------
A0A2I2YJV4_BCL2A1-      ttgcgttctcagtccaaaaagaag--------------------------
A0A2I2YPX6_BCL2L2-      agcccccggcagccaagag-------gaggaggaggagcc------ggga
A0A2I2YPX6_BCL2L2-      ------------ccaagag-------gaggaggaggagcc------ggga
A0A2I2YPX6_BCL2L2-      ctgcactgtgtgctgagagtgtcaacaaggagatggaaccactggtggga
A0A2I2YPX6_BCL2L2-      ctgcactgtgtgctgagagtgtcaacaaggagatggaaccactggtggga
G3QLU6_BCL2L10-01       tggcgctgatgg--------------------------------------
G3QES9_BCL2-01          cggtgccacctg--------------------------------------
A0A2I2YJ87_MCL1-02      cggcgccgcttgaggagatggaagccccggccgccgacgccatcatgtcg
A0A2I2YJ87_MCL1-01      cggcgccgcttgaggagatggaagccccggccgccgacgccatcatgtcg
A0A2I2YJ87_MCL1-03      --------------------------------------------------

A0A2I2YJV4_BCL2A1-      -------------------------------------------------t
A0A2I2YJV4_BCL2A1-      -------------------------------------------------t
A0A2I2YJV4_BCL2A1-      -------------------------------------------------t
A0A2I2YPX6_BCL2L2-      c--------tggtcgaggg------------------------------t
A0A2I2YPX6_BCL2L2-      c--------tggtcgaggg------------------------------t
A0A2I2YPX6_BCL2L2-      caagtgcaggagtggatgg------------------------------t
A0A2I2YPX6_BCL2L2-      caagtgcaggagtggatgg------------------------------t
G3QLU6_BCL2L10-01       -------------------------------------------------c
G3QES9_BCL2-01          -------------------------------------------------t
A0A2I2YJ87_MCL1-02      cccgaagaggagctggacgggtacgagccggagcctctcgggaagcggcc
A0A2I2YJ87_MCL1-01      cccgaagaggagctggacgggtacgagccggagcctctcgggaagcggcc
A0A2I2YJ87_MCL1-03      --------------------------------------------------

A0A2I2YJV4_BCL2A1-      gga-----------------------------------------------
A0A2I2YJV4_BCL2A1-      gga-----------------------------------------------
A0A2I2YJV4_BCL2A1-      gga-----------------------------------------------
A0A2I2YPX6_BCL2L2-      gac---ccgg----------------------------------------
A0A2I2YPX6_BCL2L2-      gac---ccgg----------------------------------------
A0A2I2YPX6_BCL2L2-      ggcctacctg----------------------------------------
A0A2I2YPX6_BCL2L2-      ggcctacctg----------------------------------------
G3QLU6_BCL2L10-01       ggattccgtgctct------------------------------------
G3QES9_BCL2-01          ggtccacctgaccct-----------------------------------
A0A2I2YJ87_MCL1-02      ggctgtcctgcccctgctggagttggtcggggaatctggtaatgacacca
A0A2I2YJ87_MCL1-01      ggctgtcctgcccctgctggagttggtcggggaatctggtaatgacacca
A0A2I2YJ87_MCL1-03      --------------------------------------------------

A0A2I2YJV4_BCL2A1-      --------------------------------------------------
A0A2I2YJV4_BCL2A1-      --------------------------------------------------
A0A2I2YJV4_BCL2A1-      --------------------------------------------------
A0A2I2YPX6_BCL2L2-      -----------------------gggacggcgc-----------------
A0A2I2YPX6_BCL2L2-      -----------------------gggacggcgc-----------------
A0A2I2YPX6_BCL2L2-      -----------------------gagacgcggctgg--------------
A0A2I2YPX6_BCL2L2-      -----------------------gagacgcggctgg--------------
G3QLU6_BCL2L10-01       -----------------------------ccgacag--------------
G3QES9_BCL2-01          -----------------------------ccgccag--------------
A0A2I2YJ87_MCL1-02      gtacggacgggtcactaccctcgacgccgccgccagcagaggaggaggag
A0A2I2YJ87_MCL1-01      gtacggacgggtcactaccctcgacgccgccgccagcagaggaggaggag
A0A2I2YJ87_MCL1-03      --------------------------------------------------

A0A2I2YJV4_BCL2A1-      --------------------------------------------------
A0A2I2YJV4_BCL2A1-      --------------------------------------------------
A0A2I2YJV4_BCL2A1-      --------------------------------------------------
A0A2I2YPX6_BCL2L2-      ------------------------------------------------ca
A0A2I2YPX6_BCL2L2-      ------------------------------------------------ca
A0A2I2YPX6_BCL2L2-      --------------------------------ctgactggatccacagca
A0A2I2YPX6_BCL2L2-      --------------------------------ctgactggatccacagca
G3QLU6_BCL2L10-01       --------------------------------------------------
G3QES9_BCL2-01          --------------------gccggcgacgacttctc-------------
A0A2I2YJ87_MCL1-02      gacgagttgtaccggcagtcgctggagattatctctcggtaccttcggga
A0A2I2YJ87_MCL1-01      gacgagttgtaccggcagtcgctggagattatctctcggtaccttcggga
A0A2I2YJ87_MCL1-03      --------------------------------------------------

A0A2I2YJV4_BCL2A1-      ----------------------aaagaatctgaagtcatgcttggacaat
A0A2I2YJV4_BCL2A1-      ----------------------aaagaatctgaagtcatgcttggacaat
A0A2I2YJV4_BCL2A1-      ----------------------aaagaatctgaagtcatgcttggacaat
A0A2I2YPX6_BCL2L2-      ttgaggacccggagctgg----aagctatcaaagctcgagtcagggagat
A0A2I2YPX6_BCL2L2-      ttgaggacccggagctgg----aagctatcaaagctcgagtcagggagat
A0A2I2YPX6_BCL2L2-      gtgggggctgggagctgg----aagctatcaaagctcgagtcagggagat
A0A2I2YPX6_BCL2L2-      gtgggggctgggcg----------gagttcacagctctatacggggacgg
G3QLU6_BCL2L10-01       ------ccccggccccac-----------------------ctggggcag
G3QES9_BCL2-01          --------ccgccgctaccgccgcgacttcgccgag-atgtc-----cag
A0A2I2YJ87_MCL1-02      gcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggcaa
A0A2I2YJ87_MCL1-01      gcaggccaccggcgccaaggacacaaagccaatgggcaggtctggggcaa
A0A2I2YJ87_MCL1-03      ----gccaccggcgccaaggacacaaagccaatgggcaggtctggggcaa

A0A2I2YJV4_BCL2A1-      gttaatgttgtgtccatagacactg---------ccagaacactgttcaa
A0A2I2YJV4_BCL2A1-      gttaatgttgtgtccatagacactg---------ccagaacactgttcaa
A0A2I2YJV4_BCL2A1-      gttaatgttgtgtccatagacactg---------ccagaacactgttcaa
A0A2I2YPX6_BCL2L2-      gga---ggaagaagctgagaagc-----------taaaggagctacagaa
A0A2I2YPX6_BCL2L2-      gga---ggaagaagctgagaagc-----------taaaggagctacagaa
A0A2I2YPX6_BCL2L2-      gga---ggaagaagctgagaagc-----------taaaggagctacagaa
A0A2I2YPX6_BCL2L2-      ggccctggaggaggcgcggcgtc-----------tgcgggag--------
G3QLU6_BCL2L10-01       --agtggtgacgctcgtga---ccttcg------cagggacgctgc----
G3QES9_BCL2-01          ccagc-----tgcacctgacgcccttcaccgcg-cggggacgctttgc--
A0A2I2YJ87_MCL1-02      ccagcaggaaggcgctggagaccttacgacgggttggggatggcgtgcag
A0A2I2YJ87_MCL1-01      ccagcaggaaggcgctggagaccttacgacgggttggggatggcgtgcag
A0A2I2YJ87_MCL1-03      ccagcaggaaggcgctggagaccttacgacgggttggggatggcgtgcag
                                      *       *                           

A0A2I2YJV4_BCL2A1-      ccaagtgatggaaaaggagtttgaa-------------------------
A0A2I2YJV4_BCL2A1-      ccaagtgatggaaaaggagtttgaa-------------------------
A0A2I2YJV4_BCL2A1-      ccaagtgatggaaaaggagtttgaa-------------------------
A0A2I2YPX6_BCL2L2-      cgaggtagagaagcagatgaatatg-------------------------
A0A2I2YPX6_BCL2L2-      cgaggtagagaagcagatgaatatg-------------------------
A0A2I2YPX6_BCL2L2-      cgaggtagagaagcagatgaatatg-------------------------
A0A2I2YPX6_BCL2L2-      -------gggaactgggcatcagtg-------------------------
G3QLU6_BCL2L10-01       -----tggagagagggccgctggtg-------------------------
G3QES9_BCL2-01          cacggtggtggaggagctcttcagg-------------------------
A0A2I2YJ87_MCL1-02      cgcaaccacgagacggccttccaa--------------------------
A0A2I2YJ87_MCL1-01      cgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaa
A0A2I2YJ87_MCL1-03      cgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaa
                                 *     *                                  

A0A2I2YJV4_BCL2A1-      --------------------------------------------------
A0A2I2YJV4_BCL2A1-      --------------------------------------------------
A0A2I2YJV4_BCL2A1-      --------------------------------------------------
A0A2I2YPX6_BCL2L2-      -------------------------agtccacctccaggcaatgctggac
A0A2I2YPX6_BCL2L2-      -------------------------agtccacctccaggcaatgctggac
A0A2I2YPX6_BCL2L2-      -------------------------agtccacctccaggcaatgctggac
A0A2I2YPX6_BCL2L2-      -------------------------ag----------gacagtgct----
G3QLU6_BCL2L10-01       --------------------------------------------------
G3QES9_BCL2-01          --------------------------------------------------
A0A2I2YJ87_MCL1-02      --------------------------------------------------
A0A2I2YJ87_MCL1-01      aaacgaagacgatgtgaaatcgttgtctcgagtgatgatccatgttttca
A0A2I2YJ87_MCL1-03      aaacgaagacgatgtgaaatcgttgtctcgagtgatgatccatgttttca

A0A2I2YJV4_BCL2A1-      --gacggcatcattaactggggaagaattgtaacc---------atattt
A0A2I2YJV4_BCL2A1-      --gacggcatcattaactggggaagaattgtaacc---------atattt
A0A2I2YJV4_BCL2A1-      --gacggcatcattaactggggaagaattgtaacc---------atattt
A0A2I2YPX6_BCL2L2-      cagtgatcatgtccattgaggagaagatggaggctgatgcccgttccatc
A0A2I2YPX6_BCL2L2-      cagtgatcatgtccattgaggagaagatggaggctgatgcccgttccatc
A0A2I2YPX6_BCL2L2-      cagtgatcatgtccattgaggagaagatggaggctgatgcccgttccatc
A0A2I2YPX6_BCL2L2-      -------------------------gacgggggccg--------------
G3QLU6_BCL2L10-01       ----------accgcccggtggaagaagtggggct---------tccagc
G3QES9_BCL2-01          -----gacggggtgaactgggggaggattgtggcc---------ttcttt
A0A2I2YJ87_MCL1-02      --------------------------------------------------
A0A2I2YJ87_MCL1-01      gcgacggcgtaacaaactggggcaggattgtgact---------ctcatt
A0A2I2YJ87_MCL1-03      gcgacggcgtaacaaactggggcaggattgtgact---------ctcatt

A0A2I2YJV4_BCL2A1-      gcatttgaaggtattctcatcaagaaacttctacgacagca---------
A0A2I2YJV4_BCL2A1-      gcatttgaaggtattctcatcaagaaacttctacgacagca---------
A0A2I2YJV4_BCL2A1-      gcatttgaaggtattctcatcaagaaacttctacgacagca---------
A0A2I2YPX6_BCL2L2-      tatgttggcaa---tgtggactatggtgcaacagcagaagagctggaagc
A0A2I2YPX6_BCL2L2-      tatgttggcaa---tgtggactatggtgcaacagcagaagagctggaagc
A0A2I2YPX6_BCL2L2-      tatgttggcaa---tgtggactatggtgcaacagcagaagagctggaagc
A0A2I2YPX6_BCL2L2-      -----tggcac---tgggggccctggt-----------------------
G3QLU6_BCL2L10-01       --------------cgcggctaaaggagcaggagggcga-----------
G3QES9_BCL2-01          gagttcgg------tggggtca----tgtgtgtggagag-----------
A0A2I2YJ87_MCL1-02      --------------------------------------------------
A0A2I2YJ87_MCL1-01      tcttttggtgcctttgtggcta----aacacttgaagac-----------
A0A2I2YJ87_MCL1-03      tcttttggtgcctttgtggcta----aacacttgaagac-----------

A0A2I2YJV4_BCL2A1-      ---------------------aattgccccgg------------------
A0A2I2YJV4_BCL2A1-      ---------------------aattgccccgg------------------
A0A2I2YJV4_BCL2A1-      ---------------------aattgccccgg------------------
A0A2I2YPX6_BCL2L2-      tcactttcatggctgtggttcagtcaaccgtgttaccatactctgtgaca
A0A2I2YPX6_BCL2L2-      tcactttcatggctgtggttcagtcaaccgtgttaccatactctgtgaca
A0A2I2YPX6_BCL2L2-      tcactttcatggctgtggttcagtcaaccgtgttaccatactctgtgaca
A0A2I2YPX6_BCL2L2-      -------------------------------------------------a
G3QLU6_BCL2L10-01       ---------------------cgtcgcccggg-----------------a
G3QES9_BCL2-01          ---------------------cgtcaaccggg-----------------a
A0A2I2YJ87_MCL1-02      --------------------------------------------------
A0A2I2YJ87_MCL1-01      ---------------------cataaaccaag-----------------a
A0A2I2YJ87_MCL1-03      ---------------------cataaaccaag-----------------a

A0A2I2YJV4_BCL2A1-      ---atgtggatacttataaggagatttcatattttg--------------
A0A2I2YJV4_BCL2A1-      ---atgtggatacttataaggagatttcatattttg--------------
A0A2I2YJV4_BCL2A1-      ---atgtggatacttataaggagatttcatattttg--------------
A0A2I2YPX6_BCL2L2-      aatttagtggccatcccaaagggtttgcatatatagagttctcagacaaa
A0A2I2YPX6_BCL2L2-      aatttagtggccatcccaaagggtttgcatatatagagttctcagacaaa
A0A2I2YPX6_BCL2L2-      aatttagtggccatcccaaagggtttgcatatatagagttctcagacaaa
A0A2I2YPX6_BCL2L2-      actgtaggggcctt------------------------------------
G3QLU6_BCL2L10-01       -------------ctgccagcg--------------------c-------
G3QES9_BCL2-01          gatgtct------cccctggtggacaacatcgc---------c-------
A0A2I2YJ87_MCL1-02      --------------------------------------------------
A0A2I2YJ87_MCL1-01      aagctgcatcgaaccattagcagaaagtatcacagacgttctc-------
A0A2I2YJ87_MCL1-03      aagctgcatcgaaccattagcagaaagtatcacagacgttctc-------

A0A2I2YJV4_BCL2A1-      ------ttgcggagttca--------------------------------
A0A2I2YJV4_BCL2A1-      ------ttgcggagttca--------------------------------
A0A2I2YJV4_BCL2A1-      ------ttgcggagttca--------------------------------
A0A2I2YPX6_BCL2L2-      gagtcagtgaggacttccttggccttagatgagtccctatttagaggaag
A0A2I2YPX6_BCL2L2-      gagtcagtgaggacttccttggccttagatgagtccctatttagaggaag
A0A2I2YPX6_BCL2L2-      gagtcagtgaggacttccttggccttagatgagtccctatttagaggaag
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
G3QLU6_BCL2L10-01       ------ctggtggccttgctgagct-------------------------
G3QES9_BCL2-01          ------ctgtggat-------gact-------------------------
A0A2I2YJ87_MCL1-02      --------------------------------------------------
A0A2I2YJ87_MCL1-01      ------gtaaggacaaaacgggact-------------------------
A0A2I2YJ87_MCL1-03      ------gtaaggacaaaacgggact-------------------------

A0A2I2YJV4_BCL2A1-      --------------------------------------------------
A0A2I2YJV4_BCL2A1-      --------------------------------------------------
A0A2I2YJV4_BCL2A1-      --------------------------------------------------
A0A2I2YPX6_BCL2L2-      gcaaatca---------------------------------------agg
A0A2I2YPX6_BCL2L2-      gcaaatca---------------------------------------agg
A0A2I2YPX6_BCL2L2-      gcaaatcaaggttgactttaaggctatcatttgttcatctctgactcagg
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
G3QLU6_BCL2L10-01       ------------------------------------------------cg
G3QES9_BCL2-01          ------------------------------------------------ga
A0A2I2YJ87_MCL1-02      --------------------------------------------------
A0A2I2YJ87_MCL1-01      ------------------------------------------------gg
A0A2I2YJ87_MCL1-03      ------------------------------------------------gg

A0A2I2YJV4_BCL2A1-      -----taatgaataacacaggagaatggataaggcaaaacggaggctggg
A0A2I2YJV4_BCL2A1-      -----taatgaataacacaggagaatggataaggcaaaacggaggct-gg
A0A2I2YJV4_BCL2A1-      -----taatgaataacacaggagaatggataaggcaaaacggaggct-gg
A0A2I2YPX6_BCL2L2-      tgatcccaaaacgaaccaacagaccaggcatcagcacaacaga--ccggg
A0A2I2YPX6_BCL2L2-      tgatcccaaaacgaaccaacagaccaggcatcagcacaacaga--ccggg
A0A2I2YPX6_BCL2L2-      tgatcccaaaacgaaccaacagaccaggcatcagcacaacaga--ccggg
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
G3QLU6_BCL2L10-01       -cggctcatggggcagcaccgcgcctggctgcaggctcagggcggctggg
G3QES9_BCL2-01          gtacctgaaccggcacctgcacacctggatccaggataacggaggctggg
A0A2I2YJ87_MCL1-02      ------------------------------------------------gg
A0A2I2YJ87_MCL1-01      ctagttaaac----------------------------aaagaggctggg
A0A2I2YJ87_MCL1-03      ctagttaaac----------------------------aaagaggctggg

A0A2I2YJV4_BCL2A1-      ggaaatggc-------acaatcac---------acgcctatg-ctggtag
A0A2I2YJV4_BCL2A1-      gaaaatggctttgtaaagaagttt---------gaacctaaatctggctg
A0A2I2YJV4_BCL2A1-      gaaaatggctttgtaaagaagttt---------gaacctaaatctggctg
A0A2I2YPX6_BCL2L2-      ----gttttccacgagcccgctaccgcgcccggaccaccaactacaacag
A0A2I2YPX6_BCL2L2-      ----gttttccacgagcccgctaccgcgcccggaccaccaactacaacag
A0A2I2YPX6_BCL2L2-      ----gttttccacgagcccgctaccgcgcccggaccaccaactacaacag
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
G3QLU6_BCL2L10-01       ----atggcttttgtcacttcttc-------aggacccc-----------
G3QES9_BCL2-01          ----atgcctttgtggaactgtac--------ggccccagcatgcggcct
A0A2I2YJ87_MCL1-02      ----atgggtttgtggagttcttccatgtagaggacctagaaggtggcat
A0A2I2YJ87_MCL1-01      ----atgggtttgtggagttcttccatgtagaggacctagaaggtggcat
A0A2I2YJ87_MCL1-03      ----atgggtttgtggagttcttccatgtagaggacctagaaggtggcat

A0A2I2YJV4_BCL2A1-      ----------------agtcagtggcccacaagaagaggaaaatggc---
A0A2I2YJV4_BCL2A1-      ----------------gatgacttttctagaagttacgggaaagatc---
A0A2I2YJV4_BCL2A1-      ----------------gatgacttttctagaagttacgggaaagatctca
A0A2I2YPX6_BCL2L2-      ttcccgctctcgattctacagtggttttaacagcaggccccggggtc---
A0A2I2YPX6_BCL2L2-      ttcccgctctcgattctacagtggttttaacagcaggccccggggtc---
A0A2I2YPX6_BCL2L2-      ttcccgctctcgattctacagtggttttaacagcaggccccggggtc---
A0A2I2YPX6_BCL2L2-      ------------------------ttttgctagcaag-------------
G3QLU6_BCL2L10-01       ----------ctttccgctggct-ttttggagaaaacagctggtcca---
G3QES9_BCL2-01          ctg---tttgatttctcctggctgtctctgaagactctgctcagttt---
A0A2I2YJ87_MCL1-02      caggaatgtg----ctgctggct---tttgcaggtgttgctggagta---
A0A2I2YJ87_MCL1-01      caggaatgtg----ctgctggct---tttgcaggtgttgctggagta---
A0A2I2YJ87_MCL1-03      caggaatgtg----ctgctggct---tttgcaggtgttgctggagta---

A0A2I2YJV4_BCL2A1-      --------------------------------------------------
A0A2I2YJV4_BCL2A1-      ------------------------------tgtgaaat---gctatctct
A0A2I2YJV4_BCL2A1-      atactgttgaccagaaaggacactccatattgtgaaaccggcctaatttt
A0A2I2YPX6_BCL2L2-      --------------------------------------------gcgtct
A0A2I2YPX6_BCL2L2-      --------------------------------------------gcgtct
A0A2I2YPX6_BCL2L2-      --------------------------------------------gcgtct
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
G3QLU6_BCL2L10-01       --------------------------------------------ggcttt
G3QES9_BCL2-01          --------------------------------------------ggc---
A0A2I2YJ87_MCL1-02      --------------------------------------------gga---
A0A2I2YJ87_MCL1-01      --------------------------------------------gga---
A0A2I2YJ87_MCL1-03      --------------------------------------------gga---

A0A2I2YJV4_BCL2A1-      ---------------------------------------tttgtaa----
A0A2I2YJV4_BCL2A1-      cct----------gaagcaa-----------------tactgttga----
A0A2I2YJV4_BCL2A1-      tctgactgttatggaaacgattgccaacacatacttctacttttaa----
A0A2I2YPX6_BCL2L2-      acaggg--gccgggctagagcgacatcatggtattccccttactaa----
A0A2I2YPX6_BCL2L2-      acaggg--gccgggctagagcgacatcatggtattccccttactaa----
A0A2I2YPX6_BCL2L2-      acaggg--gccgggctagagcgacatcatggtattccccttactaa----
A0A2I2YPX6_BCL2L2-      -------------------------------------------tga----
G3QLU6_BCL2L10-01       tctgtcatgcttgt------tagcaacagccttcatttatctctg-----
G3QES9_BCL2-01          --------cctggtgggagcttgcatcaccctgggtgcctatctgggcca
A0A2I2YJ87_MCL1-02      --------gctggt------ttg-------------gcatatcta----a
A0A2I2YJ87_MCL1-01      --------gctggt------ttg-------------gcatatcta----a
A0A2I2YJ87_MCL1-03      --------gctggt------ttg-------------gcatatcta----a

A0A2I2YJV4_BCL2A1-      -------------------
A0A2I2YJV4_BCL2A1-      -------------------
A0A2I2YJV4_BCL2A1-      -------------------
A0A2I2YPX6_BCL2L2-      -------------------
A0A2I2YPX6_BCL2L2-      -------------------
A0A2I2YPX6_BCL2L2-      -------------------
A0A2I2YPX6_BCL2L2-      -------------------
G3QLU6_BCL2L10-01       ---gacacgattattatga
G3QES9_BCL2-01          caagtga------------
A0A2I2YJ87_MCL1-02      taagatagccttactgtaa
A0A2I2YJ87_MCL1-01      taagatag-----------
A0A2I2YJ87_MCL1-03      taagatag-----------

© 1998-2021Legal notice