Dataset for CDS BCL-2-like of organism Gorilla gorilla gorilla

[Download (right click)] [Edit] [Sequences] [Repertoires]

8 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2I2YML2_BCL2A1-      atga-----------cagact-----gtgaatttggatatatttacagg-
A0A2I2YML2_BCL2A1-      atga-----------cagact-----gtgaatttggatatatttacagg-
A0A2I2YPX6_BCL2L2-      atggcgaccccagcctcggcc--ccagacacacgggctctggtggcaga-
A0A2I2YPX6_BCL2L2-      atggcgaccccagcctcggcc--ccagacacacgggctctggtggcaga-
G3QLU6_BCL2L10-01       atgg-----------ttgaccagtggcgggagcgcaccaccatggccga-
G3QES9_BCL2-01          atgg-----------cgcacg--ctgggagaacagggtacgataaccgag
A0A2I2YQH7_MCL1-03      atgt-----------ttggcc--tcaaaagaa----acgcggtaatcgg-
A0A2I2YQH7_MCL1-01      atgt-----------ttggcc--tcaaaagaa----acgcggtaatcgg-
                        ***                *                      *    *  

A0A2I2YML2_BCL2A1-      -----------------------------ctagctcaggactat------
A0A2I2YML2_BCL2A1-      -----------------------------ctagctcaggactat------
A0A2I2YPX6_BCL2L2-      -------------ctttgtaggttataagctgaggcagaagggttatgtc
A0A2I2YPX6_BCL2L2-      -------------ctttgtaggttataagctgaggcagaagggttatgtc
G3QLU6_BCL2L10-01       ----------------------------cccgctgcgggagcgcaccgag
G3QES9_BCL2-01          agatagtgatgaagtacatccattataagctgtcgcagaggggctacgag
A0A2I2YQH7_MCL1-03      -----------------actcaacct---ctactgtgggggggc--cggc
A0A2I2YQH7_MCL1-01      -----------------actcaacct---ctactgtgggggggc--cggc
                                                     *       *            

A0A2I2YML2_BCL2A1-      -------------------ctgcagtacgtcctaca--------------
A0A2I2YML2_BCL2A1-      -------------------ctgcagtacgtcctaca--------------
A0A2I2YPX6_BCL2L2-      tgtggagctgg----------------ccccgggga--------------
A0A2I2YPX6_BCL2L2-      tgtggagctgg----------------ccccgggga--------------
G3QLU6_BCL2L10-01       c-ggttgctg-----------gccgactacctgggg--------------
G3QES9_BCL2-01          tgggatgcgggagatgtgggcgccgtgcccccgggggccgcccccgcacc
A0A2I2YQH7_MCL1-03      ttgggggccggcagcggcggcgccacccctccggga--------------
A0A2I2YQH7_MCL1-01      ttgggggccggcagcggcggcgccacccctccggga--------------

A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
G3QLU6_BCL2L10-01       ---------------------------tactgcgcccgg-----------
G3QES9_BCL2-01          gggcatcttctc---------------ctcccagcccgg-----------
A0A2I2YQH7_MCL1-03      gggcgactttta--------------------------------------
A0A2I2YQH7_MCL1-01      gggcgacttttagctacggagaaggaggcctcggcccggcgagagatagg

A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
G3QLU6_BCL2L10-01       --------------------------------------------------
G3QES9_BCL2-01          ----------------------------------------gcacacgccc
A0A2I2YQH7_MCL1-03      --------------------------------------------------
A0A2I2YQH7_MCL1-01      gggaggggaggccggcgcggtgattggcggaagcgccggcgcaagccccc

A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
G3QLU6_BCL2L10-01       --------------------------------------------------
G3QES9_BCL2-01          catccagccgcatcccgggacc-----gggtcgccaggacctcgcc----
A0A2I2YQH7_MCL1-03      --------------------------------------------------
A0A2I2YQH7_MCL1-01      cgtccaccctcacgccagactcccggagggtcgcgcggccgccgcccatt

A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
G3QLU6_BCL2L10-01       --------------------------------------------------
G3QES9_BCL2-01          --------------------------------------------------
A0A2I2YQH7_MCL1-03      --------------------------------------------------
A0A2I2YQH7_MCL1-01      ggcgccgaggtccccgacgtcaccgcgacccccgcgaggctgcttttctt

A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
G3QLU6_BCL2L10-01       --------------------------------------------------
G3QES9_BCL2-01          ---------------------------------gctgcagaccccggct-
A0A2I2YQH7_MCL1-03      --------------------------------------------------
A0A2I2YQH7_MCL1-01      tgcgcccacccgccgcgcggcgccgcttgaggagatggaagccccggccg

A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
G3QLU6_BCL2L10-01       --------------------------------------------------
G3QES9_BCL2-01          --------------------------------------------------
A0A2I2YQH7_MCL1-03      --------------------------------------------------
A0A2I2YQH7_MCL1-01      ccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggag

A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
G3QLU6_BCL2L10-01       --------------------------------------------------
G3QES9_BCL2-01          --------------------------------------------------
A0A2I2YQH7_MCL1-03      --------------------------------------------------
A0A2I2YQH7_MCL1-01      cctctcgggaagcggccggctgtcctgcccctgctggagttggtcgggga

A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
G3QLU6_BCL2L10-01       --------------------------------------------------
G3QES9_BCL2-01          --------------------------------------------------
A0A2I2YQH7_MCL1-03      --------------------------------------------------
A0A2I2YQH7_MCL1-01      atctggtaatgacaccagtacggacgggtcactaccctcgacgccgccgc

A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
G3QLU6_BCL2L10-01       --------------------------------------------------
G3QES9_BCL2-01          --------------------------------------------------
A0A2I2YQH7_MCL1-03      --------------------------------------------------
A0A2I2YQH7_MCL1-01      cagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatc

A0A2I2YML2_BCL2A1-      ---------------------gataccacaacc--tggatcaggtccaag
A0A2I2YML2_BCL2A1-      ---------------------gataccacaacc--tggatcaggtccaag
A0A2I2YPX6_BCL2L2-      ---------------------gggcccagcagc-----------------
A0A2I2YPX6_BCL2L2-      ---------------------gggcccagcagc-----------------
G3QLU6_BCL2L10-01       ---------------------gaacccggcacccccgagccgacgcc---
G3QES9_BCL2-01          ---------------------gcccccggcgcc---gccgcggggcctgc
A0A2I2YQH7_MCL1-03      ---------------------gccaccggcgccaaggacacaaagccaat
A0A2I2YQH7_MCL1-01      tctcggtaccttcgggagcaggccaccggcgccaaggacacaaagccaat
                                             *   **     *                 

A0A2I2YML2_BCL2A1-      caaaacgtccagagtgctacaaaaggttgcgttctcagtccaaaaagaag
A0A2I2YML2_BCL2A1-      caaaacgtccagagtgctacaaaaggttgcgttctcagtccaaaaagaag
A0A2I2YPX6_BCL2L2-      --------------tgacccgc-------tgcaccaagccatgcgggcag
A0A2I2YPX6_BCL2L2-      --------------tgacccgc-------tgcaccaagccatgcgggcag
G3QLU6_BCL2L10-01       gtccacgcccgaggccgcc---------gtgctgc--gctccgcggccgc
G3QES9_BCL2-01          gctca-gcccggtgccacctgt-----ggtccacctgaccctccgccagg
A0A2I2YQH7_MCL1-03      gggcaggtctggggcaaccagcaggaaggcgctggagaccttacgacggg
A0A2I2YQH7_MCL1-01      gggcaggtctggggcaaccagcaggaaggcgctggagaccttacgacggg

A0A2I2YML2_BCL2A1-      tggaaaagaat--ctgaagtcatgcttggacaatgttaatgttgtgtcca
A0A2I2YML2_BCL2A1-      tggaaaagaat--ctgaagtcatgcttggacaatgttaatgttgtgtcca
A0A2I2YPX6_BCL2L2-      ctggagatgag--ttcgagacccgcttccggcgcacc---------ttct
A0A2I2YPX6_BCL2L2-      ctggagatgag--ttcgagacccgcttccggcgcacc---------ttct
G3QLU6_BCL2L10-01       caggttacggcagattcaccggtccttcttctccgcc---------tacc
G3QES9_BCL2-01          ccggcgacgac--ttctcccgccgctaccgccgcgac---------ttcg
A0A2I2YQH7_MCL1-03      ttggggatggc--gtgcagcgcaaccacgagacggcc---------ttcc
A0A2I2YQH7_MCL1-01      ttggggatggc--gtgcagcgcaaccacgagacggcc---------ttcc
                          *   *       *         *                     * * 

A0A2I2YML2_BCL2A1-      tagacactgccagaacactgttca--------------------------
A0A2I2YML2_BCL2A1-      tagacactgccagaacactgttca--------------------------
A0A2I2YPX6_BCL2L2-      ctgatctggcggctcagctgcatgtgaccccaggctcagcccaacaacg-
A0A2I2YPX6_BCL2L2-      ctgatctggcggctcagctgcatgtgaccccaggctcagcccaacaacg-
G3QLU6_BCL2L10-01       tcggc-taccccgggaaccgcttc-------------gagctggtggcg-
G3QES9_BCL2-01          ccgagatgtccagccagctgcacctgacgcccttcaccgcgcggggacg-
A0A2I2YQH7_MCL1-03      aaggcatgcttcggaaactggacatca----------aaaacgaagacga
A0A2I2YQH7_MCL1-01      aaggcatgcttcggaaactggacatca----------aaaacgaagacga
                          *              * *                              

A0A2I2YML2_BCL2A1-      --------------accaagtgatggaaaa------ggagtttgaagacg
A0A2I2YML2_BCL2A1-      --------------accaagtgatggaaaa------ggagtttgaagacg
A0A2I2YPX6_BCL2L2-      --------cttcacccaggtctccgatgaa------ctttttcaaggg--
A0A2I2YPX6_BCL2L2-      --------cttcacccaggtctccgatgaa------ctttttcaaggg--
G3QLU6_BCL2L10-01       -------------------ctgatggcggattccgtgctctccgacagcc
G3QES9_BCL2-01          --------ctttgccacg-gtggtggagga------gctcttcagggacg
A0A2I2YQH7_MCL1-03      tgtgaaatcgttgtctcgagtgatgatcca------tgttttcagcgacg
A0A2I2YQH7_MCL1-01      tgtgaaatcgttgtctcgagtgatgatcca------tgttttcagcgacg
                                                *    *          *         

A0A2I2YML2_BCL2A1-      gcatcattaactggggaagaattgtaaccatatttgcattt---------
A0A2I2YML2_BCL2A1-      gcatcattaactggggaagaattgtaaccatatttgcattt---------
A0A2I2YPX6_BCL2L2-      --ggccccaactggggccgccttgtagccttctttgtcttt-----gggg
A0A2I2YPX6_BCL2L2-      --ggccccaactggggccgccttgtagccttctttgtcttt-----gggg
G3QLU6_BCL2L10-01       ccggccccacctggggcagagtggtgacgctcgtgaccttcgcagggacg
G3QES9_BCL2-01          gggt---gaactgggggaggattgtggccttctttgagttc-----gg--
A0A2I2YQH7_MCL1-03      gcgtaacaaactggggcaggattgtgactctcatttctttt-----ggtg
A0A2I2YQH7_MCL1-01      gcgtaacaaactggggcaggattgtgactctcatttctttt-----ggtg
                                * ******  *  * **  *  *  *    **          

A0A2I2YML2_BCL2A1-      -----gaaggtattctcatcaagaaacttctacgacagcaaat-------
A0A2I2YML2_BCL2A1-      -----gaaggtattctcatcaagaaacttctacgacagcaaat-------
A0A2I2YPX6_BCL2L2-      ct------gcactgtgtgctg-agagtgtcaacaaggaga---------t
A0A2I2YPX6_BCL2L2-      ct------gcactgtgtgctg-agagtgtcaacaaggaga---------t
G3QLU6_BCL2L10-01       ctgctggagagagggccgctggtgaccgcccggtggaagaagtggggctt
G3QES9_BCL2-01          ----tggggtcatgtgtg-tggagagcgtcaaccgggaga--t---gtct
A0A2I2YQH7_MCL1-03      cctttgtggctaaacact-tgaagaccataaaccaagaaagct---gcat
A0A2I2YQH7_MCL1-01      cctttgtggctaaacact-tgaagaccataaaccaagaaagct---gcat
                                *               *              *          

A0A2I2YML2_BCL2A1-      --tgccccg------------gatgtggatactta------------taa
A0A2I2YML2_BCL2A1-      --tgccccg------------gatgtggatactta------------taa
A0A2I2YPX6_BCL2L2-      ggaaccact------------ggtgggacaagt--------------gca
A0A2I2YPX6_BCL2L2-      ggaaccact------------ggtgggacaagt--------------gca
G3QLU6_BCL2L10-01       ccagccgcggctaaaggagcaggagggcgacgtcgc-----------ccg
G3QES9_BCL2-01          ----cccct------------ggtggacaacatcgc---------cctgt
A0A2I2YQH7_MCL1-03      cgaaccatt------------agcagaaagtatcacagacgttctcgtaa
A0A2I2YQH7_MCL1-01      cgaaccatt------------agcagaaagtatcacagacgttctcgtaa
                            **                          *                 

A0A2I2YML2_BCL2A1-      ggagatttcatattttg-----ttgcggagttcataatgaataacacag-
A0A2I2YML2_BCL2A1-      ggagatttcatattttg-----ttgcggagttcataatgaataacacag-
A0A2I2YPX6_BCL2L2-      gga------gtggatggtggcctacctgga------------gacgcggc
A0A2I2YPX6_BCL2L2-      gga------gtggatggtggcctacctgga------------gacgcggc
G3QLU6_BCL2L10-01       ggactgccagcgcctggtggccttgctgagctcgcggctcatggggcagc
G3QES9_BCL2-01          ggat-------gactga----gtacctgaacc------------ggcacc
A0A2I2YQH7_MCL1-03      ggacaaaacgggactgg----ctagttaaac-------------------
A0A2I2YQH7_MCL1-01      ggacaaaacgggactgg----ctagttaaac-------------------
                        ***           *       *                           

A0A2I2YML2_BCL2A1-      ---gagaatggataaggcaaaacggaggct-ggga---------------
A0A2I2YML2_BCL2A1-      ---gagaatggataaggcaaaacggaggctggggg---------------
A0A2I2YPX6_BCL2L2-      tggctgactggatccacagcagtgggggctgggcg------gagttcaca
A0A2I2YPX6_BCL2L2-      tggctgactggatccacagcagtgggggctgggagctggaagctatcaaa
G3QLU6_BCL2L10-01       accgcgcctggctgcaggctcagggcggctgggat------ggcttttgt
G3QES9_BCL2-01          tgcacacctggatccaggataacggaggctgggat------gcctttgtg
A0A2I2YQH7_MCL1-03      ---------------------aaagaggctgggat------gggtttgtg
A0A2I2YQH7_MCL1-01      ---------------------aaagaggctgggat------gggtttgtg
                                                * **** **                 

A0A2I2YML2_BCL2A1-      --------------aaatggctttgtaaagaagtttgaacctaaa-----
A0A2I2YML2_BCL2A1-      --------------aaatggc-------acaatcacacgcctatg-----
A0A2I2YPX6_BCL2L2-      gctctatac-ggggacggggccctggaggaggcgcggcgtctgcgggag-
A0A2I2YPX6_BCL2L2-      gctcgagtc-agggagatgga---ggaagaagctgagaagctaaaggagc
G3QLU6_BCL2L10-01       cacttcttc-------aggacccc---------------------ctttc
G3QES9_BCL2-01          gaactgtac--------ggccccagcatgcggcctctg---tttgatttc
A0A2I2YQH7_MCL1-03      gagttcttccatgtagaggacctagaaggtggcatcaggaatgtg----c
A0A2I2YQH7_MCL1-01      gagttcttccatgtagaggacctagaaggtggcatcaggaatgtg----c

A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------gggaactgggcatcagtgag----------gacagt
A0A2I2YPX6_BCL2L2-      tacagaacgaggtagagaagcagatgaatatgagtccacctccaggcaat
G3QLU6_BCL2L10-01       cgc-----------------tggct-ttttggag----------aaaaca
G3QES9_BCL2-01          tcc-----------------tggctgtctctgaa----------gactct
A0A2I2YQH7_MCL1-03      tgc-----------------tggct---tttgca----------ggtgtt
A0A2I2YQH7_MCL1-01      tgc-----------------tggct---tttgca----------ggtgtt

A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2I2YPX6_BCL2L2-      gct-----------------------------gacgggggccg-------
A0A2I2YPX6_BCL2L2-      gctggaccagtgatcatgtccattgaggagaagatggaggctgatgcccg
G3QLU6_BCL2L10-01       gctggtcc------------------------------------------
G3QES9_BCL2-01          gctcagtt------------------------------------------
A0A2I2YQH7_MCL1-03      gctggagt------------------------------------------
A0A2I2YQH7_MCL1-01      gctggagt------------------------------------------

A0A2I2YML2_BCL2A1-      ---------------------------tctggc-----------------
A0A2I2YML2_BCL2A1-      ----------------------------ctggt-----------------
A0A2I2YPX6_BCL2L2-      ------------tggcactgggggc--cctggt-----------------
A0A2I2YPX6_BCL2L2-      ttccatctatgttggcaatgtggac--tatggtgcaacagcagaagagct
G3QLU6_BCL2L10-01       ------------aggcttttctgtcatgcttgt-----------------
G3QES9_BCL2-01          ------------tggc-----------cctggt-----------------
A0A2I2YQH7_MCL1-03      ------------agga-----------gctggt-----------------
A0A2I2YQH7_MCL1-01      ------------agga-----------gctggt-----------------
                                                     * *                  

A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
A0A2I2YPX6_BCL2L2-      ggaagctcactttcatggctgtggttcagtcaaccgtgttaccatactct
G3QLU6_BCL2L10-01       ------------------------------------------------ta
G3QES9_BCL2-01          ------------------------------------------gggagctt
A0A2I2YQH7_MCL1-03      ------------------------------------------------tt
A0A2I2YQH7_MCL1-01      ------------------------------------------------tt

A0A2I2YML2_BCL2A1-      -------------tggatg-------------------------------
A0A2I2YML2_BCL2A1-      -------------agagtc-------------------------------
A0A2I2YPX6_BCL2L2-      -----aactgtaggggcctt------------------------------
A0A2I2YPX6_BCL2L2-      gtgacaaatttagtggccatcccaaagggtttgcatatatagagttctca
G3QLU6_BCL2L10-01       gcaacagccttcatttatc-------------------------------
G3QES9_BCL2-01          gcatcaccctgggtgccta-------------------------------
A0A2I2YQH7_MCL1-03      g-------------gcata-------------------------------
A0A2I2YQH7_MCL1-01      g-------------gcata-------------------------------

A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
A0A2I2YPX6_BCL2L2-      gacaaagagtcagtgaggacttccttggccttagatgagtccctatttag
G3QLU6_BCL2L10-01       --------------------------------------------------
G3QES9_BCL2-01          --------------------------------------------------
A0A2I2YQH7_MCL1-03      --------------------------------------------------
A0A2I2YQH7_MCL1-01      --------------------------------------------------

A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
A0A2I2YPX6_BCL2L2-      aggaaggcaaatcaaggttgactttaaggctatcatttgttcatctctga
G3QLU6_BCL2L10-01       --------------------------------------------------
G3QES9_BCL2-01          --------------------------------------------------
A0A2I2YQH7_MCL1-03      --------------------------------------------------
A0A2I2YQH7_MCL1-01      --------------------------------------------------

A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
A0A2I2YPX6_BCL2L2-      ctcaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagac
G3QLU6_BCL2L10-01       --------------------------------------------------
G3QES9_BCL2-01          --------------------------------------------------
A0A2I2YQH7_MCL1-03      --------------------------------------------------
A0A2I2YQH7_MCL1-01      --------------------------------------------------

A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2I2YML2_BCL2A1-      --------------------------------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------------
A0A2I2YPX6_BCL2L2-      cggggttttccacgagcccgctaccgcgcccggaccaccaactacaacag
G3QLU6_BCL2L10-01       --------------------------------------------------
G3QES9_BCL2-01          --------------------------------------------------
A0A2I2YQH7_MCL1-03      --------------------------------------------------
A0A2I2YQH7_MCL1-01      --------------------------------------------------

A0A2I2YML2_BCL2A1-      ------------------------acttttctagaag----------tta
A0A2I2YML2_BCL2A1-      ------------------------agtggcccacaag----------aag
A0A2I2YPX6_BCL2L2-      ------------------------ttttgctagcaag-------------
A0A2I2YPX6_BCL2L2-      ttcccgctctcgattctacagtggttttaacagcaggccccggggtcgcg
G3QLU6_BCL2L10-01       ------------------------tctgg---acacg-------------
G3QES9_BCL2-01          ------------------------tctgggccacaag-------------
A0A2I2YQH7_MCL1-03      ------------------------tcta----ataag-------------
A0A2I2YQH7_MCL1-01      ------------------------tcta----ataag-------------
                                                  *       * *             

A0A2I2YML2_BCL2A1-      cgggaaagatctgtgaaatgctatctctcctgaagcaatactgttga
A0A2I2YML2_BCL2A1-      aggaaaatggctttgtaa-----------------------------
A0A2I2YPX6_BCL2L2-      --------------------------------------------tga
A0A2I2YPX6_BCL2L2-      tctacaggggccgggctagagcgacatcatggtattccccttactaa
G3QLU6_BCL2L10-01       -------------------------------------attattatga
G3QES9_BCL2-01          -------------------------------------tga-------
A0A2I2YQH7_MCL1-03      -------------------------------------atag------
A0A2I2YQH7_MCL1-01      -------------------------------------atag------

© 1998-2020Legal notice