Dataset for CDS Unclassified of organism Ornithorhynchus anatinus

[Download (right click)]

2 sequence(s)

>gnl|bcl2dbcds|A0A6I8PDU7_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Ornithorhynchus anatinus (length=597 residues).
atggcccagcccgggaccagcggtgacgcccaccgggacctcgtggtcaagttcatcggctacaagctggcccagcgagg
ctaccactgggaacccagcggagggtcggcggccccggcccccgccccccgcctccggccgccgccccccgccgtccacc
tggccctgcgccgggccggggaccacttctcccgacgctaccggagggacttcgccgacatgtccggccagctgcacctg
accccctccaccgcccgggcccgcttcgccgccgtggtggacgagctcttccgcgacggggtcaactggggccgcatcgt
ggccttcttcgagttcgggggggccctgtgcgtggagagcgtccatcgggagatggcctccccggtggacggcatcgccc
agtggatgacggactacctcggccgacggctgcacccctggatccaggagcacggaggctgggacgcctttgtggagctg
tacggagagccggcgcggccgaggctggatctctcgtggttttctctcaagaccctgctcagcctggttgtggtgggggc
ctgcatcaccttgggggcttacttcgggcacaagtga
>gnl|bcl2dbcds|A0A6I8PDU7_uncBCL2-02 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Ornithorhynchus anatinus (length=606 residues).
atggcccagcccgggaccagcggtgacgcccaccgggacctcgtggtcaagttcatcggctacaagctggcccagcgagg
ctaccactgggaacccagcggagggtcggcggccccggcccccgccccccgcctccggccgccgccccccgccgtccacc
tggccctgcgccgggccggggaccacttctcccgacgctaccggagggacttcgccgacatgtccggccagctgcacctg
accccctccaccgcccgggcccgcttcgccgccgtggtggacgagctcttccgcgacggggtcaactggggccgcatcgt
ggccttcttcgagttcgggggggccctgtgcgtggagagcgtccatcgggagatggcctccccggtggacggcatcgccc
agtggatgacggactacctcggccgacggctgcacccctggatccaggagcacggaggctgggtctgggcccacaagggc
cctgctccagatctgttccgcgccaggtccggctggaccgtagtgggcagcttgacgcctgtgctgccgctgggcgggag
agcccccgtccgcaggccagcagccttcccgggactccatcgttaa
© 1998-2020Legal notice