Dataset for CDS BOK of Organism Danio rerio

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

B0S7M3_BOK-01          atgcgggacatgaacgtgttcgcgcgctcctccgtgctcgccgccgagat
B2GRX5_BOK-01          ---------atgaacgtgttcgcgcgctcctccgtgctcgccgccgagat
Q7T381_BOK-01          ---------atgaacgtgttcgcgcgctcctccgtgctcgccgccgagat
A0A0R4IZP5_BOK-02      atgaagggcatggagatgttgcgccgctcctcagtgtttgcggctgaagt
A0A0R4IZP5_BOK-01      atgaagggcatggagatgttgcgccgctcctcagtgtttgcggctgaagt
Q6DC66_BOK-01          ---------atggagatgttgcgccgctcctcagtgtttgcggctgaagt
                                *** *  ****    ******** *** * ** ** **  *

B0S7M3_BOK-01          gatggatgtgtttgatcgcactcacacggagaaagagctcgtctttcagt
B2GRX5_BOK-01          gattgatgtgtttgatcgcactcacacggagaaagagctcgtctttcagt
Q7T381_BOK-01          gattgatgtgtttgatcgcactcacacggagaaagagctcgtctttcagt
A0A0R4IZP5_BOK-02      catggaggtgtttgatcgctctcccacggacaaggagctcgtgtctcagt
A0A0R4IZP5_BOK-01      catggaggtgtttgatcgctctcccacggacaaggagctcgtgtctcagt
Q6DC66_BOK-01          catggaggtgtttgatcgctctcccacggacaaggagctcgtgtctcagt
                        ** ** ************ *** ****** ** ******** * *****

B0S7M3_BOK-01          ccaaggagctgtgtagagacttcattcactccaggatcacgagagaagga
B2GRX5_BOK-01          ccaaggagctgtgtagagacttcattcactccaggatcacgagagaagga
Q7T381_BOK-01          ccaaggagctgtgtagagacttcattcactccaggatcacgagagaagga
A0A0R4IZP5_BOK-02      ccaaagtgttgtgtagggattatattcactccagactgcaccgggctgga
A0A0R4IZP5_BOK-01      ccaaagtgttgtgtagggattatattcactccagactgcaccgggctgga
Q6DC66_BOK-01          ccaaagtgttgtgtagggattatattcactccagactgcaccgggctgga
                       **** * * ******* ** *  ***********  *     * *  ***

B0S7M3_BOK-01          ctgagttggtcaaaagtcgagc-tggacctgccagaaccgcgcggagttc
B2GRX5_BOK-01          ctgagttggtcaaaagtcgagc-tggacctgccagaaccgcgcggagttc
Q7T381_BOK-01          ctgagttggtcaaaagtcgagc-tggacctgccagaaccgcgcggagttc
A0A0R4IZP5_BOK-02      atcgggtggtcgaaaccagaacacgggtctggaggaacc----------c
A0A0R4IZP5_BOK-01      atcgggtggtcgaaaccagaacacgggtctggaggaacc----------c
Q6DC66_BOK-01          atcgggtggtcgaaaccagaacacgggtctggaggaacc----------c
                        *  * ***** ***   ** *  **  ***   *****          *

B0S7M3_BOK-01          ttgtagacgtgtctgtggtgctgcttaaactgggtgatgaactggagtgc
B2GRX5_BOK-01          ttgtagacgtgtctgtggtgctgcttaaactgggtgatgaactggagtgc
Q7T381_BOK-01          ttgtagacgtgtctgtggtgctgcttaaactgggtgatgaactggagtgc
A0A0R4IZP5_BOK-02      tggctgaggtgtcttcagtcctgctgtggttgggtgatgagctagagtac
A0A0R4IZP5_BOK-01      tggctgaggtgtcttcagtcctgctgtggttgggtgatgagctagagtac
Q6DC66_BOK-01          tggctgaggtgtcttcagtcctgctgtggttgggtgatgagctagagtac
                       * *  ** ******   ** *****     ********** ** **** *

B0S7M3_BOK-01          atgcgtccatatgtgtatcgtaatattgcaaagcagctgaatatcagcgt
B2GRX5_BOK-01          atgcgtccatatgtgtatcgtaatattgcaaagcagctgaatatcagcgt
Q7T381_BOK-01          atgcgtccatatgtgtatcgtaatattgcaaagcagctgaatatcagcgt
A0A0R4IZP5_BOK-02      ctgcgtcccaacgtctaccgcaacgtagctcgacagctcaacatcacaat
A0A0R4IZP5_BOK-01      ctgcgtcccaacgtctaccgcaacgtagctcgacagctcaacatcacaat
Q6DC66_BOK-01          ctgcgtcccaacgtgtaccgcaacgtagctcgacagctcaacatcacaat
                        *******  * ** ** ** **  * **    ***** ** ****   *

B0S7M3_BOK-01          atcggtggaagctgtggtttcagatgcatttctctcggtagcaacagaag
B2GRX5_BOK-01          atcggtggaagctgtggtttcagatgcatttctctcggtagcaacagaag
Q7T381_BOK-01          atcggtggaagctgtggtttcagatgcatttctctcggtagcaacagaag
A0A0R4IZP5_BOK-02      agcctctgagaatatcgtctctgatgcctttctggccgtcgctgctgaaa
A0A0R4IZP5_BOK-01      agcctctgagaatatcgtctctgatgcctttctggccgtcgctgctgaaa
Q6DC66_BOK-01          agcctctgagaatatcgtctctgatgcctttctggccgtcgctgctgaaa
                       * *    **   * * ** ** ***** *****  * ** **  * *** 

B0S7M3_BOK-01          tcatagccat---------------------------------gggaatc
B2GRX5_BOK-01          tcatagccat---------------------------------gggaatc
Q7T381_BOK-01          tcatagccat---------------------------------gggaatc
A0A0R4IZP5_BOK-02      tcttctccacaggctctgtct------gttt------ctttacaggtgta
A0A0R4IZP5_BOK-01      tcttctccacagaatatagtcgaaaaggtttggaaaaacataagggtgta
Q6DC66_BOK-01          tcttctccacagaatatagtcgaaaaggtttggaaaaacataagggtgta
                       ** *  ***                                   **  * 

B0S7M3_BOK-01          acatggggtaaagtggtggccatctacgctgtagctgccgggcttgcggt
B2GRX5_BOK-01          acatggggtaaagtggtggccatctacgctgtagctgccgggcttgcggt
Q7T381_BOK-01          acatggggtaaagtggtggccatctacgctgtagctgccgggcttgcggt
A0A0R4IZP5_BOK-02      acatgggggaagattgtgtctctgtatgcagtggctggagctctagctgt
A0A0R4IZP5_BOK-01      acatgggggaagattgtgtctctgtatgcagtggctggagctctagctgt
Q6DC66_BOK-01          acatgggggaagattgtgtctctgtatgcagtggctggagctctagctgt
                       ******** **  * *** *  * ** ** ** ****  *  ** ** **

B0S7M3_BOK-01          ggactgtgtgcgactgggccatcctgtcatggtgcacactattgtggaca
B2GRX5_BOK-01          ggactgtgtgcgactgggccatcctgtcatggtgcacactattgtggaca
Q7T381_BOK-01          ggactgtgtgcgactgggccatcctgtcatggtgcacactattgtggaca
A0A0R4IZP5_BOK-02      ggactgtgttcggcatggacatccagcaatggtgcacactatcgtcgact
A0A0R4IZP5_BOK-01      ggactgtgttcggcatggacatccagcaatggtgcacactatcgtcgact
Q6DC66_BOK-01          ggactgtgttcggaatggacatccagcaatggtgcacactatcgtcgact
                       ********* **    ** ***** *  ************** ** *** 

B0S7M3_BOK-01          gtctgggagagtttgtgcggagaagtctcgtgccatggctcaaaaagaga
B2GRX5_BOK-01          gtctgggagagtttgtgcggagaagtctcgtgccatggctcaaaaagaga
Q7T381_BOK-01          gtctgggagagtttgtgcggagaagtctcgtgccatggctcaaaaagaga
A0A0R4IZP5_BOK-02      gcatgggcgagtttgttcgcaaaagccttgcgtcatggttaaagaagaga
A0A0R4IZP5_BOK-01      gcatgggcgagtttgttcgcaaaagccttgcgtcatggttaaagaagaga
Q6DC66_BOK-01          gcatgggcgagtttgttcgcaaaagccttgcgtcatggttaaagaagaga
                       *  **** ******** ** * *** ** * * ***** * ** ******

B0S7M3_BOK-01          ggaggatgggttgacattttaaaatgtgtggtgaacatggactctagagc
B2GRX5_BOK-01          ggaggatgggttgacattttaaaatgtgtggtaaacatggactctagagc
Q7T381_BOK-01          ggaggatgggttgacattttaaaatgtgtggtaaacatggactctagagc
A0A0R4IZP5_BOK-02      ggaggctgggcggacataacaaagtgtgtcgtcagtacagaccccagttt
A0A0R4IZP5_BOK-01      ggaggctgggcggacataacaaagtgtgtcgtcagtacagaccccagttt
Q6DC66_BOK-01          ggaggctgggcggacataacaaagtgtgtcgtcagtacagaccccagttt
                       ***** ****  *****   *** ***** ** *  *  *** * **   

B0S7M3_BOK-01          tcatgtccattggttatcgacagcagtgttaacatggagggaattcataa
B2GRX5_BOK-01          tcatgtccattggttatcgacagcagtgttaacatggagggaattcataa
Q7T381_BOK-01          tcatgtccattggttatcgacagcagtgttaacatggagggaattcataa
A0A0R4IZP5_BOK-02      ccactctcactggctagtaacggccgcctgcgcctgcggtcactacctta
A0A0R4IZP5_BOK-01      ccactctcactggctagtaacggccgcctgcgcctgcggtcactacctta
Q6DC66_BOK-01          ccactctcactggctagtaacggccgcctgcgcctgcggtcactacctta
                        **    ** *** **   ** ** *  *   * **  *  * * * * *

B0S7M3_BOK-01          agactatgtacgtctacctgacgaagtag------
B2GRX5_BOK-01          agactatgtacgtctacctgacgaagtag------
Q7T381_BOK-01          agactatgtacgtctacctgacgaagtag------
A0A0R4IZP5_BOK-02      aggctgtggttttctacctgctgagagagaaatga
A0A0R4IZP5_BOK-01      aggctgtggttttctacctgctgagagagaaatga
Q6DC66_BOK-01          aggctgtggttttctacctgctgagagagaaatga
                       ** ** **    ********  **   **      

© 1998-2023Legal notice