Dataset for CDS BCL-2-like of organism Serinus canaria

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C9NN65_BCL2L1-      atgtacagcagtaaccgggagttagtgattgactttgtttcctaca----
A0A8C9MQN0_BCL2A1-      atggaaactgctgagttctattacgtttactacttag---ctcagg----
A0A8C9MG30_BCL2-01      atgaagtgtgatggtctttatttca--aagcattta----ctcaaaaaag
A0A8C9NTQ6_MCL1-01      atggaacaaactgcattttg---ca--gagcccctggagtcccaca----
                        *** *      *                      *     *  *      

A0A8C9NN65_BCL2L1-      ----------------agctctcacagaaaggatacagctggagtcagct
A0A8C9MQN0_BCL2A1-      -actatctgcagtatgtgctc-----------------caggaatcacac
A0A8C9MG30_BCL2-01      tgttttcccccctttttactttaa-----gaaattttacaggtg------
A0A8C9NTQ6_MCL1-01      -----tcgcccattttggctcttaccgt-ggcgcccaacgtgcggcaccc
                                          **                  *  *        

A0A8C9NN65_BCL2L1-      ggaggaggaggatgagaa-caggactgactt----tgcaggggaggagga
A0A8C9MQN0_BCL2A1-      ctcggaccagccc--agaccagggttg--------ctcatgtcttgagaa
A0A8C9MG30_BCL2-01      -taataaaagtttaagaatcagagatggatgttcctgtttgtctagaaga
A0A8C9NTQ6_MCL1-01      ttagtaggagcct--gaatgagggatg--------tgggtgtccag----
                             *  **       *  **   **             *    *    

A0A8C9NN65_BCL2L1-      c----------------------------gagatggacggggtcctcaac
A0A8C9MQN0_BCL2A1-      c----------------------------------catggcatcctctct
A0A8C9MG30_BCL2-01      ctgtttggatcacctattccttcgtgcagaacctgcctgctttgctcctc
A0A8C9NTQ6_MCL1-01      ----------------------------------gcctgc---------c
                                                              *           

A0A8C9NN65_BCL2L1-      gggagcccctcctggcacgcgg--ccaccagcca----------------
A0A8C9MQN0_BCL2A1-      ccaagaccaaaccga---ggaggctctcaggccactcct-----------
A0A8C9MG30_BCL2-01      tgcagtttcatctga---gaag--ttgctgtccaatcctttttcacagag
A0A8C9NTQ6_MCL1-01      tgcagctggagctg----gcag--ctgtggtcccacattgct--------
                           **      * *    *  *         **                 

A0A8C9NN65_BCL2L1-      -------------catagtgaatggagccaccgt--gcaccagagcagcc
A0A8C9MQN0_BCL2A1-      ----------ggacaggattgacatcacctctgt----------------
A0A8C9MG30_BCL2-01      cagaaagacagggcatgggcggcactgcctcagtcacaagcacagaggct
A0A8C9NTQ6_MCL1-01      -------------cattttggctcctgcccccgt-----------gggtt
                                     **            ** * **                

A0A8C9NN65_BCL2L1-      tcgaagtccatgagatc-cgtcga--------------------------
A0A8C9MQN0_BCL2A1-      ------------agctgttgccaa--------------------------
A0A8C9MG30_BCL2-01      acgataaccgggagatagtgctgaagtacatccactataaactctctcag
A0A8C9NTQ6_MCL1-01      ttg----caggga-----tgctga--------------------------
                                    *      *   *                          

A0A8C9NN65_BCL2L1-      --------------------------------------------------
A0A8C9MQN0_BCL2A1-      -gagaattt----------tcaatggagtcatg-----------------
A0A8C9MG30_BCL2-01      aggggatacgactggcctgccagcgaggacagggcatccctgcctccagg
A0A8C9NTQ6_MCL1-01      ggaggctgcagat------ccagcaggaggagg--------acctgcaga
                                                                          

A0A8C9NN65_BCL2L1-      ----------------------gcagccgatgtg----------------
A0A8C9MQN0_BCL2A1-      ----------------------gaagaaaagtttgctgatggaaat----
A0A8C9MG30_BCL2-01      tctctctgctcctgctgctgctgcggttgctgctgctgctgggacttcct
A0A8C9NTQ6_MCL1-01      gc--------------------gtggtggaggtggctgcccagatgttca
                                              *  *                        

A0A8C9NN65_BCL2L1-      --------------------------------------------------
A0A8C9MQN0_BCL2A1-      ----------------------------------actaactgg-------
A0A8C9MG30_BCL2-01      ctgatcacactgggctggtgtctccgcaccccgagccccctggctcggcc
A0A8C9NTQ6_MCL1-01      gtga-----------cggtgtc------------accaactgg-------
                                                                          

A0A8C9NN65_BCL2L1-      -----------------------aggcaggcgctga--------------
A0A8C9MQN0_BCL2A1-      -----------------------ggacgaattatgaccatatttaca---
A0A8C9MG30_BCL2-01      gctgctagccacgcgcccccagcagaggggctgcgccccgcaccccaggt
A0A8C9NTQ6_MCL1-01      -----------------------ggacgggtggtgaccctcatcac----
                                                *         *               

A0A8C9NN65_BCL2L1-      -----------------gagaggcgggggatgagtttgagctgaggtacc
A0A8C9MQN0_BCL2A1-      tttggaggtcttctc--accaagaag--------------cttcaagagc
A0A8C9MG30_BCL2-01      cgtccaccttgtcctgcgccaggcgggggacgagttctcccgacgctacc
A0A8C9NTQ6_MCL1-01      cttcggcgccttcgtg-gccaagcacctgaagag--catccagcaggagc
                                            * *                 *      * *

A0A8C9NN65_BCL2L1-      ggcgggcgttcagcgacctcacttcccagctcca----catcactcccag
A0A8C9MQN0_BCL2A1-      atgggg------ttcagctgactgcagaggagaaggagcagatctcttat
A0A8C9MG30_BCL2-01      agagggacttcgcccaaatgtctggccagctgcac--ctgacgccct--t
A0A8C9NTQ6_MCL1-01      agagca-------tcagcagcctggctggcatcatcaccgacgccctggt
                           *           *     **     *    *         * *    

A0A8C9NN65_BCL2L1-      cacagcgtatcagagctttgagcaggt--agtgaacgaactgttccgcga
A0A8C9MQN0_BCL2A1-      ttcatcacagagtacatcataaacaacaaagccgaatggattgatgcgaa
A0A8C9MG30_BCL2-01      cacggccaggagccgcttcgtggcggt--ggtggaggagctcttccgaga
A0A8C9NTQ6_MCL1-01      ctcctccaaga----------gggagt--ggctggagagcc--------a
                          *  *                        *                  *

A0A8C9NN65_BCL2L1-      tggagtgaactggggccgcatcgtggctttcttctccttcggaggagcct
A0A8C9MQN0_BCL2A1-      tggtg---gctgggaaa-----atggcttcctaacaa-------------
A0A8C9MG30_BCL2-01      tggggttaactggggcagaattgtggccttcttcgagtttggcggtgtga
A0A8C9NTQ6_MCL1-01      ggggg---gctgggagggctttgtggactttttc----------------
                         ** *    *****         ***  *  *                  

A0A8C9NN65_BCL2L1-      tgtgcgtggagagcgttgttaaggagatgcgggtattggtgaaacgcatc
A0A8C9MQN0_BCL2A1-      ---------------------------------agtttgaaagaagatc-
A0A8C9MG30_BCL2-01      tgtgcgtggagagcgtcaaccgggagatgtctcaccttgtggacagcatt
A0A8C9NTQ6_MCL1-01      --cgcgtggagg---------------------acctggagggcagcat-
                                                            * *      *    

A0A8C9NN65_BCL2L1-      gtgtcttggatg-accacgtacttgaccgaccacttagatccctggatcc
A0A8C9MQN0_BCL2A1-      -------------actactgtccttctccaa-------------------
A0A8C9MG30_BCL2-01      gccacctggatg-actgagtacctgaaccggcagctgcacaactggatcc
A0A8C9NTQ6_MCL1-01      ----ccggaacgttctgatggccttcgcggg-------------------
                                      *      * *   *                      

A0A8C9NN65_BCL2L1-      aggagaatggcggatgggagcgctttgtggacctctatgggaacgatgct
A0A8C9MQN0_BCL2A1-      -----aattacagc------------------------------------
A0A8C9MG30_BCL2-01      aggacaacggaggctggg--------------------------------
A0A8C9NTQ6_MCL1-01      --------ggtggccgg---------------------------------
                                    *                                     

A0A8C9NN65_BCL2L1-      gctgccgaggtgagaaaaggccaggagaccttcaacaaatggctcctgac
A0A8C9MQN0_BCL2A1-      --------------------------------------------cctgtt
A0A8C9MG30_BCL2-01      -------------------------------------taagtcccccgac
A0A8C9NTQ6_MCL1-01      --------------------------------------------cctggg
                                                                    ** *  

A0A8C9NN65_BCL2L1-      cggggcgacggtggccggagtgcttctgctgggatccctgctgagccgca
A0A8C9MQN0_BCL2A1-      ca---------------------ttgctgttgtttccttgttcagag---
A0A8C9MG30_BCL2-01      tg---------------------ctcggttcctctgccggctccggcccc
A0A8C9NTQ6_MCL1-01      gg---------------------ccagcctggcctacatgatccggt---
                                                     *    * *  * *  *     

A0A8C9NN65_BCL2L1-      agt------ga
A0A8C9MQN0_BCL2A1-      agtactactga
A0A8C9MG30_BCL2-01      tggctggtggg
A0A8C9NTQ6_MCL1-01      ---------ga
                                 * 

© 1998-2023Legal notice