Dataset for CDS BCL-2-like of organism Panthera leo

[Download (right click)] [Edit] [Sequences] [Repertoires]

8 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A8C8XJU8_BCL2-01      atggcgcac-----------------------------------------
A0A8C8WKU6_BCL2L10      atg-----------------------------------------------
A0A8C8XCR9_BCL2L2-      atggcgacc-----------------------------ccagcctcagcc
A0A8C8Y0M9_MCL1-01      atg-----t-----------------------------ttggcctca---
A0A8C8Y0M9_MCL1-02      atg-----t-----------------------------ttggcctca---
A0A8C9D5N1_BCL2L1-      atgtctcagagcaa------------------------ccggga------
A0A8C8X938_BCL2A1-      atggcggacggcgagtttgggtacgttctcacgctggcccgggactatac
A0A8C8X938_BCL2A1-      atggcgg-cggcga---------------------cggccgtga------

A0A8C8XJU8_BCL2-01      ------------gctggg---agaacagggtatgataaccgggagatagt
A0A8C8WKU6_BCL2L10      ------------gctg----------------------------------
A0A8C8XCR9_BCL2L2-      ccagacacacgggctcta------------------------------gt
A0A8C8Y0M9_MCL1-01      --agagaaac--gctgta------------------------------at
A0A8C8Y0M9_MCL1-02      --agagaaac--gctgta------------------------------at
A0A8C9D5N1_BCL2L1-      ------------gctggt----------------------ggttgacttt
A0A8C8X938_BCL2A1-      gaagcacgttctgcaggggccccagcccgggtgccacccaagcagagtat
A0A8C8X938_BCL2A1-      ------------gcagcg-------------------ccaagcggagc--

A0A8C8XJU8_BCL2-01      catgaagtacatccactata------------------------------
A0A8C8WKU6_BCL2L10      -----------------atg------------------------------
A0A8C8XCR9_BCL2L2-      ggcagactttgtaggctata------------------------------
A0A8C8Y0M9_MCL1-01      --cggact---caacctcta------------------------------
A0A8C8Y0M9_MCL1-02      --cggact---caacctcta------------------------------
A0A8C9D5N1_BCL2L1-      ctc---tcctacaagctttccc------------------agaaaggata
A0A8C8X938_BCL2A1-      cccaagtgctacaagacgtggccttctcggtccagggggaggtcgagaag
A0A8C8X938_BCL2A1-      --------ctgcgggccg--------------------------------

A0A8C8XJU8_BCL2-01      -agctgtcgcaga--------ggggcta----------------------
A0A8C8WKU6_BCL2L10      -cgttgagggagcgccgcctactgactg----------------------
A0A8C8XCR9_BCL2L2-      -agctgaggcaga--------agggtta----------------------
A0A8C8Y0M9_MCL1-01      -ctgtgggggggc--------cgggctg----------------------
A0A8C8Y0M9_MCL1-02      -ctgtgggggggc--------cgggctg----------------------
A0A8C9D5N1_BCL2L1-      cagctggagtca-----------gttta----------------------
A0A8C8X938_BCL2A1-      cagctgaagccgt----------gcctggacaagttccacgtggggtcgg
A0A8C8X938_BCL2A1-      -agctgaagcagc----------gtctg----------------------
                            **  *              *  *                       

A0A8C8XJU8_BCL2-01      -------cgagtgggatgc----------cggggacgcgggcgccgcgcc
A0A8C8WKU6_BCL2L10      --------------actac----------ctggagtac--------tgcg
A0A8C8XCR9_BCL2L2-      --------------tgttt----------gtggagcag---------gcc
A0A8C8Y0M9_MCL1-01      --------------gcggc----------cgggagcggcggcgcctcctc
A0A8C8Y0M9_MCL1-02      --------------gcggc----------cgggagcggcggcgcctcctc
A0A8C9D5N1_BCL2L1-      --------------gtgat----------gtggaagagaacagaactgag
A0A8C8X938_BCL2A1-      tagacacggccaggacgatgttccaccaagtgatggagaaggaatttgaa
A0A8C8X938_BCL2A1-      -----------cgggcgat-------------------------------

A0A8C8XJU8_BCL2-01      --------------------------------------------------
A0A8C8WKU6_BCL2L10      --------------------------------------------------
A0A8C8XCR9_BCL2L2-      --------------------------------------------------
A0A8C8Y0M9_MCL1-01      --------------------------------------------------
A0A8C8Y0M9_MCL1-02      --------------------------------------------------
A0A8C9D5N1_BCL2L1-      gc------------------------------------------------
A0A8C8X938_BCL2A1-      gacggcatcatcaactggggcaggattgtgactatatttgcgtttgaggg
A0A8C8X938_BCL2A1-      --------------------------------------------------

A0A8C8XJU8_BCL2-01      ------------------------------------cccggg-----ggc
A0A8C8WKU6_BCL2L10      ------------------------------------cccgggagcccggc
A0A8C8XCR9_BCL2L2-      ------------------------------------ctggggag---ggc
A0A8C8Y0M9_MCL1-01      ------------------------------------ttcgggag---ggc
A0A8C8Y0M9_MCL1-02      ------------------------------------ttcgggag---ggc
A0A8C9D5N1_BCL2L1-      ------------------------------------cccagaag--ggac
A0A8C8X938_BCL2A1-      catcctcatcaagaagcttctccaggagcggatcgtcccagacg--cgga
A0A8C8X938_BCL2A1-      -------------------------gagcg------ccgaggag--cggc
                                                                *      *  

A0A8C8XJU8_BCL2-01      cgccc---------------------------------------------
A0A8C8WKU6_BCL2L10      agccc---------------------------------------------
A0A8C8XCR9_BCL2L2-      --------------------------------------------------
A0A8C8Y0M9_MCL1-01      ggcttgtggctgtggggaaggaggccacggcccggcgagaggtaggggga
A0A8C8Y0M9_MCL1-02      ggcttgt-------------------------------------------
A0A8C9D5N1_BCL2L1-      tgaat---------------------------------------------
A0A8C8X938_BCL2A1-      tgcgt---------------------------------------------
A0A8C8X938_BCL2A1-      tgcg----------------------------------------------

A0A8C8XJU8_BCL2-01      --------------------------------------------------
A0A8C8WKU6_BCL2L10      --------------------------------------------------
A0A8C8XCR9_BCL2L2-      --------------------------------------------------
A0A8C8Y0M9_MCL1-01      ggggaagccggtgcggtgattggcggaagcgccggcgcgagccccccagc
A0A8C8Y0M9_MCL1-02      --------------------------------------------------
A0A8C9D5N1_BCL2L1-      --------------------------------------------------
A0A8C8X938_BCL2A1-      --------------------------------------------------
A0A8C8X938_BCL2A1-      --------------------------------------------------

A0A8C8XJU8_BCL2-01      --------------------------------------------------
A0A8C8WKU6_BCL2L10      --------------------------------------------------
A0A8C8XCR9_BCL2L2-      --------------------------------------------------
A0A8C8Y0M9_MCL1-01      cactctcgcgcccgacgcccggagggtcgcgcggccctcgcccattggtg
A0A8C8Y0M9_MCL1-02      --------------------------------------------------
A0A8C9D5N1_BCL2L1-      --------------------------------------------------
A0A8C8X938_BCL2A1-      --------------------------------------------------
A0A8C8X938_BCL2A1-      --------------------------------------------------

A0A8C8XJU8_BCL2-01      --------------------------------------------------
A0A8C8WKU6_BCL2L10      --------------------------------------------------
A0A8C8XCR9_BCL2L2-      --------------------------------------------------
A0A8C8Y0M9_MCL1-01      ccgagggccccgacgtcaccgcgacccctccgaagctgctgttcttcgcg
A0A8C8Y0M9_MCL1-02      --------------------------------------------------
A0A8C9D5N1_BCL2L1-      --------------------------------------------------
A0A8C8X938_BCL2A1-      --------------------------------------------------
A0A8C8X938_BCL2A1-      --------------------------------------------------

A0A8C8XJU8_BCL2-01      --------------------------------------------------
A0A8C8WKU6_BCL2L10      --------------------------------------------------
A0A8C8XCR9_BCL2L2-      --------------------------------------------------
A0A8C8Y0M9_MCL1-01      gccacccgctgtgcgtcgccgcctgaaaagatggaaggcccagccgccga
A0A8C8Y0M9_MCL1-02      --------------------------------------------------
A0A8C9D5N1_BCL2L1-      --------------------------------------------------
A0A8C8X938_BCL2A1-      --------------------------------------------------
A0A8C8X938_BCL2A1-      --------------------------------------------------

A0A8C8XJU8_BCL2-01      --------------------------------------------------
A0A8C8WKU6_BCL2L10      --------------------------------------------------
A0A8C8XCR9_BCL2L2-      --------------------------------------------------
A0A8C8Y0M9_MCL1-01      cgccatcatgtcgcccgaagaggaactagacgggtacgagccagaacctc
A0A8C8Y0M9_MCL1-02      --------------------------------------------------
A0A8C9D5N1_BCL2L1-      --------------------------------------------------
A0A8C8X938_BCL2A1-      --------------------------------------------------
A0A8C8X938_BCL2A1-      --------------------------------------------------

A0A8C8XJU8_BCL2-01      --------------------------------------------------
A0A8C8WKU6_BCL2L10      --------------------------------------------------
A0A8C8XCR9_BCL2L2-      --------------------------------------------------
A0A8C8Y0M9_MCL1-01      tggggaagcggccggctgtcctgcctttgctggagttggtcggggaggcc
A0A8C8Y0M9_MCL1-02      --------------------------------------------------
A0A8C9D5N1_BCL2L1-      --------------------------------------------------
A0A8C8X938_BCL2A1-      --------------------------------------------------
A0A8C8X938_BCL2A1-      --------------------------------------------------

A0A8C8XJU8_BCL2-01      --ccgcgccgggcatcttctcctc--------------------------
A0A8C8WKU6_BCL2L10      --------------------------------------------------
A0A8C8XCR9_BCL2L2-      --------------------------------------------------
A0A8C8Y0M9_MCL1-01      agcagtggccccggcacagacggctcactgccctcgacgccacccccagc
A0A8C8Y0M9_MCL1-02      --------------------------------------------------
A0A8C9D5N1_BCL2L1-      --cggagatggagacccccagtgcca------------------------
A0A8C8X938_BCL2A1-      --tcaaggtttcctacttcgttgccgagttcatcacgaaacacacgggag
A0A8C8X938_BCL2A1-      --------------------------------------------------

A0A8C8XJU8_BCL2-01      ------------------------------------------------cc
A0A8C8WKU6_BCL2L10      --------------------------------------------------
A0A8C8XCR9_BCL2L2-      --------------------------------------------------
A0A8C8Y0M9_MCL1-01      agaggaggaggaggacgagttgttccggcagtcgctggagattatctctc
A0A8C8Y0M9_MCL1-02      --------------------------------------------------
A0A8C9D5N1_BCL2L1-      ------------------------------------------------tc
A0A8C8X938_BCL2A1-      aatggatccggcaaaacggaggctgggaaaacggctttgtaaggaagttc
A0A8C8X938_BCL2A1-      ------------------------------------------------tc

A0A8C8XJU8_BCL2-01      agcccgggcgcacccctgc-------------------------gcccgc
A0A8C8WKU6_BCL2L10      --------------cgcgc---------------------ggacgccgtc
A0A8C8XCR9_BCL2L2-      --------------ccagc---------------------agctg--acc
A0A8C8Y0M9_MCL1-01      ggtaccttcgggagcaggc---------------------gactggcgcc
A0A8C8Y0M9_MCL1-02      ----------------ggc---------------------gactggcgcc
A0A8C9D5N1_BCL2L1-      aatggcaacccatcctggc-------------acttggcggacagccctg
A0A8C8X938_BCL2A1-      gaacccaagtctggctggctgacctttctggaagttacaggaaagatctg
A0A8C8X938_BCL2A1-      agtcccaactct---tggc----------------------------cca

A0A8C8XJU8_BCL2-01      caggacctccccgccgccgcccccggtcgcccccgccgcc----------
A0A8C8WKU6_BCL2L10      cac-gc-------ccgaggccgc---------------------------
A0A8C8XCR9_BCL2L2-      cactgc-------accaagccat--------------gcg----------
A0A8C8Y0M9_MCL1-01      aaggac-------gcgaaaccactgggcgggtctggggcg----------
A0A8C8Y0M9_MCL1-02      aaggac-------gcgaaaccactgggcgggtctggggcg----------
A0A8C9D5N1_BCL2L1-      cggtga-------atggagccactggccacagcagcagcttggatgcccg
A0A8C8X938_BCL2A1-      taaggt-------gatagctcacagtcagtatcagaagtc----------
A0A8C8X938_BCL2A1-      gaaggt-------gatagctcacagtcagtatcagaagtc----------

A0A8C8XJU8_BCL2-01      ----gccgccgccgccgccgcgggccctgcgctcagccccgtgccacctg
A0A8C8WKU6_BCL2L10      --------------------------------------------------
A0A8C8XCR9_BCL2L2-      --------------------------------------------------
A0A8C8Y0M9_MCL1-01      --------------------------------------------------
A0A8C8Y0M9_MCL1-02      --------------------------------------------------
A0A8C9D5N1_BCL2L1-      ggaggtgatccccat----------------ggcagcggtgaagcaggcg
A0A8C8X938_BCL2A1-      gaaaagaatctccatctttctgagcatgccagacgaagtcgagacagaag
A0A8C8X938_BCL2A1-      gaaaagaatctccatctttctgagcatgccagacgaagtcgagacagaag

A0A8C8XJU8_BCL2-01      tggtccacctgaccctgcgccaggccggcgatga----cttctcccgtcg
A0A8C8WKU6_BCL2L10      --------------------------ggtgctgc----gcta--------
A0A8C8XCR9_BCL2L2-      ------------------tgc-agctggagatga----gtttgagacccg
A0A8C8Y0M9_MCL1-01      ------------------gcc-agcc-gaaaggc----gttagagaccc-
A0A8C8Y0M9_MCL1-02      ------------------gcc-agcc-gaaaggc----gttagagaccc-
A0A8C9D5N1_BCL2L1-      -----ctgaggga---------ggccggggatga----gtttgaactgag
A0A8C8X938_BCL2A1-      agatcatcagggacattttcc-ggcaagggaagacctgcttcgtcccacg
A0A8C8X938_BCL2A1-      agatcatcagggacattttcc-ggcaagggaagacctgcttcgtcccacg
                                                   *    *       *         

A0A8C8XJU8_BCL2-01      ctaccgc----------------cgcgacttcgcggagatgtccagcc--
A0A8C8WKU6_BCL2L10      --cctgg----------------ccgcccagatacg-----gcagcgc--
A0A8C8XCR9_BCL2L2-      cttccgg----------------cgcaccttctctgatttggcagccc--
A0A8C8Y0M9_MCL1-01      --tccga----------------cgggtcggggacggcgt-gcagcgc--
A0A8C8Y0M9_MCL1-02      --tccga----------------cgggtcggggacggcgt-gcagcgc--
A0A8C9D5N1_BCL2L1-      gtaccgg----------------cgggcattcagcgacctgacatccc--
A0A8C8X938_BCL2A1-      gtaccggttccagaacaaccacatggacatgctgaga-ctgacgtccccc
A0A8C8X938_BCL2A1-      gtaccggttccagaacaaccacatggacatgctgaga-ctgacgtccccc
                           * *                             *      *    *  

A0A8C8XJU8_BCL2-01      -----agctgcacctgacaccctttaccgcaaggggacgcttt-------
A0A8C8WKU6_BCL2L10      ----------caccagcgtttcttgtcggcttaccgcggctac-------
A0A8C8XCR9_BCL2L2-      -----agttgcatgtgacccctgggtcagcccagcaacgcttc-------
A0A8C8Y0M9_MCL1-01      -----aac--cacgagacc-----gccttccaaggcatgcttcggaaact
A0A8C8Y0M9_MCL1-02      -----aac--cacgagacc-----gccttccaaggcatgcttcggaaact
A0A8C9D5N1_BCL2L1-      -----agcttcacatcaccccagggacagcatatcagagcttt-------
A0A8C8X938_BCL2A1-      gacgaaatttcgttacttccca-ggacgtcctggaatatcctt-------
A0A8C8X938_BCL2A1-      gacgaaatttcgttacttccca-ggacgtcctggaatatcctt-------
                                  *               *  *         *          

A0A8C8XJU8_BCL2-01      ---------------------------gccacggtggtggagga------
A0A8C8WKU6_BCL2L10      ----------cgcggaaaccgcgtggaactggtggcgcggttggagcggg
A0A8C8XCR9_BCL2L2-      ---------------------------acccaggtctctgatga------
A0A8C8Y0M9_MCL1-01      ggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggtcc
A0A8C8Y0M9_MCL1-02      ggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggtcc
A0A8C9D5N1_BCL2L1-      ---------------------------gagcaggtagtgaacga------
A0A8C8X938_BCL2A1-      ---------------------------cagcctggagaggatga------
A0A8C8X938_BCL2A1-      ---------------------------cagcctggagaggatga------
                                                         *        *       

A0A8C8XJU8_BCL2-01      gct---cttcagg----gatggagtgaactgggggaggattgtggcct--
A0A8C8WKU6_BCL2L10      atttactctccaacccccaaaccctcagttggggccatgtggtagcgc--
A0A8C8XCR9_BCL2L2-      act---cttccaa----gggggccccaactggggccgccttgtggcct--
A0A8C8Y0M9_MCL1-01      atg---ttttcagtgacggagtaacaaactggggcaggattgtgactc--
A0A8C8Y0M9_MCL1-02      atg---ttttcagtgacggagtaacaaactggggcaggattgtgactc--
A0A8C9D5N1_BCL2L1-      act---cttccgg----gatggggtgaactggggtcgcattgtggcct--
A0A8C8X938_BCL2A1-      g------gtccgg----gaggaag----ccttgtccacagggggacttga
A0A8C8X938_BCL2A1-      g------gtccgg----gaggaag----ccttgtccacagggggacttga
                                *                       *        *   *    

A0A8C8XJU8_BCL2-01      tctttgagttcggtggggtcatgtgtg------------tggaga-----
A0A8C8WKU6_BCL2L10      tcttgaccttcgcggggacgctgctggagagaccgccgccggggacctac
A0A8C8XCR9_BCL2L2-      tctttgtctttggagccgcactgtgtg------------ctgaga-----
A0A8C8Y0M9_MCL1-01      ttatttcttttggtgc----ctttgtggccaaacac--ttgaaga-----
A0A8C8Y0M9_MCL1-02      ttatttcttttggtgc----ctttgtggccaaacac--ttgaaga-----
A0A8C9D5N1_BCL2L1-      ttttctccttcggtggggcactgtgcg------------tggaaa-----
A0A8C8X938_BCL2A1-      tctcatctttgtgccgggtcttgggtt------------tgacaa-----
A0A8C8X938_BCL2A1-      tctcatctttgtgccgggtcttgggtt------------tgacaa-----
                        *       **           *                      *     

A0A8C8XJU8_BCL2-01      --------------gcgtcaaccgagag------atgtcgcccctggtg-
A0A8C8WKU6_BCL2L10      ttgaacctgacgccgggccagcaacaggagctggagtgggagaccaacgt
A0A8C8XCR9_BCL2L2-      --------------gtgtcaacaaggag------atggagccacttgtg-
A0A8C8Y0M9_MCL1-01      --------------gtataaaccaagaaagctgcatcgaaccattagca-
A0A8C8Y0M9_MCL1-02      --------------gtataaaccaagaaagctgcatcgaaccattagca-
A0A8C9D5N1_BCL2L1-      --------------gcgtagacaaggag------atgcaggtattggtg-
A0A8C8X938_BCL2A1-      --------------gcatggcaaccg-------------------gctg-
A0A8C8X938_BCL2A1-      --------------gcatggcaaccg-------------------gctg-

A0A8C8XJU8_BCL2-01      -gacaacatcgccctgtggatgactgagtacctgaaccg---gcacctgc
A0A8C8WKU6_BCL2L10      tggccaggactgccagcacctggtggctttgctctgcaa---tcggctca
A0A8C8XCR9_BCL2L2-      -ggacaagtgcaagagtggatggtggcctacctggagac---acggctgg
A0A8C8Y0M9_MCL1-01      -ga--aagcatcacagatgttcttg-------tgaggac---aaaacga-
A0A8C8Y0M9_MCL1-02      -ga--aagcatcacagatgttcttg-------tgaggac---aaaacga-
A0A8C9D5N1_BCL2L1-      -agtcggatcgcaacttggatggccacttacctgaacga---ccacctag
A0A8C8X938_BCL2A1-      -gggcggggc--------aagggctact-------acgactcctacctga
A0A8C8X938_BCL2A1-      -gggcggggc--------aagggctact-------acgactcctacctga

A0A8C8XJU8_BCL2-01      acac------------ctggatccaagacaacggaggctgggatgccttc
A0A8C8WKU6_BCL2L10      ccggacggcatcgggcctggctggaggctcacgacggctgggatggcttt
A0A8C8XCR9_BCL2L2-      ccga------------ctggatccacagcagtgggggctgggcggagttc
A0A8C8Y0M9_MCL1-01      --ga------------ctggctagtcaaacaaagaggctgggatgggttt
A0A8C8Y0M9_MCL1-02      --ga------------ctggctagtcaaacaaagaggctgggatgggttt
A0A8C9D5N1_BCL2L1-      agcc------------ttggatccaggagaacggcggctgggacactttt
A0A8C8X938_BCL2A1-      cgcg------------ctgtctgcagcag---------cgggactc----
A0A8C8X938_BCL2A1-      cgcg------------ctgtctgcagcag---------cgggactc----
                                         **  *                 ***        

A0A8C8XJU8_BCL2-01      gtggaactgtacggccccagcat-gcagcctctgtttgatttctcctggc
A0A8C8WKU6_BCL2L10      -tgtctcttcttctcacccatgc-------------tgccatcttcttgg
A0A8C8XCR9_BCL2L2-      acagctctatacggggacggggccctggaggaggcgcggcgtctgcggga
A0A8C8Y0M9_MCL1-01      gtggagttcttccacgtagaggacctagaag----gtggcatc-------
A0A8C8Y0M9_MCL1-02      gtggagttcttccacgtagaggacctagaag----gtggcatc-------
A0A8C9D5N1_BCL2L1-      gtggaactctacgggaacaatgcagcggccgagagccggaagggccagga
A0A8C8X938_BCL2A1-      --gaagccctac---------------accgtggccttggcgttccgaga
A0A8C8X938_BCL2A1-      --gaagccctac---------------accgtggccttggcgttccgaga

A0A8C8XJU8_BCL2-01      --------------------------tgtccctgaaggcc-ctgctcagt
A0A8C8WKU6_BCL2L10      -------------------agaagactgctggtccaggcttttctgtcat
A0A8C8XCR9_BCL2L2-      ggggaactgggcctcagtgaggacagtgctgacaggggccgtggcactgg
A0A8C8Y0M9_MCL1-01      -------------------agaaatgtgctgct---ggcttttgca--gg
A0A8C8Y0M9_MCL1-02      -------------------agaaatgtgctgct---ggcttttgca--gg
A0A8C9D5N1_BCL2L1-      -------------------gcgcttcaaccgctggttcct----gacagg
A0A8C8X938_BCL2A1-      -------------------acagatgtgcctccgggtccccgtggacgaa
A0A8C8X938_BCL2A1-      -------------------acagatgtgcctccgggtccccgtggacgaa

A0A8C8XJU8_BCL2-01      ctggccctggtgggggcttgcatcaccctgggtgcctatctgggccacaa
A0A8C8WKU6_BCL2L10      gctttacagtaatgatcttaatctactt-------ctggagaagattatc
A0A8C8XCR9_BCL2L2-      gggccctggtaactgtaggggccttttttg-----ctagcaa--------
A0A8C8Y0M9_MCL1-01      tgttgctgg----agtaggagctggtttggcatatctaataa--------
A0A8C8Y0M9_MCL1-02      tgttgctgg----agtaggagctggtttggcatatctaataa--------
A0A8C9D5N1_BCL2L1-      catgac-tgtggctggcgtggttctgctgggctcactcttcagtcggaa-
A0A8C8X938_BCL2A1-      cacgacgtgagggtggatgaagtcctttacgaagactcc--------ac-
A0A8C8X938_BCL2A1-      cacgacgtgagggtggatgaagtcctttacgaagactcc--------ac-
                                *                          **             

A0A8C8XJU8_BCL2-01      gtga-
A0A8C8WKU6_BCL2L10      gtga-
A0A8C8XCR9_BCL2L2-      gtga-
A0A8C8Y0M9_MCL1-01      gatag
A0A8C8Y0M9_MCL1-02      gatag
A0A8C9D5N1_BCL2L1-      atga-
A0A8C8X938_BCL2A1-      gtag-
A0A8C8X938_BCL2A1-      gtag-

© 1998-2023Legal notice