Dataset for CDS BAX of Organism Erpetoichthys calabaricus

[Download (right click)] [Alignment] [Repertoires]

4 sequence(s)

>gnl|bcl2dbcds|A0A8C4SXA2_BAX-01 BCL2-associated X gene OS=[Eukaryota] Erpetoichthys calabaricus GN=BAX (length=534 residues).
acttctacaattagcggaaagacagatactggtgtttttcatttatgttattttattcatgattacgtgtctcacgaaag
tgagttaaactctgaatttgatccgatttcggtacagcttcgggaccccaggcatgaaaaactcttaaacaaacttgttg
acatttcaaagaggttagatggtgatgaagaacttcagcaattaattaacgacgtccaaccaagcagggagacattccta
caggttgcacatcagttattttgtaatggaaatttgaactggggccgcctgatagctttattttactttgcctgtaaatt
ggcaatgaaggctttaaggcagaaagccgaagaaattgtgacatgtataatatcatggacaattaattatatcagggagc
atctgcttatttggatcatggatcagggtggttgggagggaatcctctcatataatcaatctttgtggcctacagtaggt
gtgttcatagcgggagtcataacggcagtggtggccatgcggcgactgtcatga
>gnl|bcl2dbcds|A0A8C4T7F8_BAX-01 BCL2-associated X gene OS=[Eukaryota] Erpetoichthys calabaricus GN=BAX (length=651 residues).
atggcatattcagccccggaagatgagtatggatgttcttgtgctgaaggtggtgatcaagtcagtgaacaagctgaagt
tgtcttgcgtggatatattttacagtcgatgaggcatgacaattgtccaggtgtgaacatcagtgcagaagatttgggtg
gatctcaaagtgaaagtacaaatcccgaagtaaaggacatagtacgaagtttgatacaaattggagatgaactaagcagg
aacactgaacttgagtaccttattgatcacattgaatttagctcagcacaggaagtttttaatattgtggccaagagaat
ttttgaagatggaattaactggggcagagtggtcgccctttttcattttgcttacaaactaatatgcaaggccataactt
caaattgcaaagagatggttagaagagtaatgtactgggcattaggattttttaggacccgcatttcctggtgggttaga
gaacaaggaggatggatgttgacgagcaataagcaaaaggtatcgctgaaaaccaccgaaaacaaaaacagcaaaaaaaa
aaaaaagtacaaggaaagttcgaagaaagaaaaaaaaatgtacaatgtttctgtttggggatcgttgtgcacaactgagc
tgcatccatag
>gnl|bcl2dbcds|A0A8C4T7F8_BAX-02 BCL2-associated X gene OS=[Eukaryota] Erpetoichthys calabaricus GN=BAX (length=597 residues).
atggcatattcagccccggaagatgagtatggatgttcttgtgctgaaggtggtgatcaagtcagtgaacaagctgaagt
tgtcttgcgtggatatattttacagtcgatgaggcatgacaattgtccaggtgtgaacatcagtgcagaagatttgggtg
gatctcaaagtgaaagtacaaatcccgaagtaaaggacatagtacgaagtttgatacaaattggagatgaactaagcagg
aacactgaacttgagtaccttattgatcacattgaatttagctcagcacaggaagtttttaatattgtggccaagagaat
ttttgaagatggaattaactggggcagagtggtcgccctttttcattttgcttacaaactaatatgcaaggccataactt
caaattgcaaagagatggttagaagagtaatgtactgggcattaggattttttaggacccgcatttcctggtgggttaga
gaacaaggaggatggggagcagttcaaagctattttcaaagtctgaactggccaaacgttgcactgtttgtagctggagt
cctcactggagctatggcatattggaaaatgtcttaa
>gnl|bcl2dbcds|A0A8C4XH90_BAX-01 BCL2-associated X gene OS=[Eukaryota] Erpetoichthys calabaricus GN=BAX (length=483 residues).
tactgttttttctctcgtttctattgcagttttatccacgatcgtgtgtctcgtgaagcagcactcacaggatcatatgg
tgatctgaactgtctaagaaaaattggtgacgagttggatggcaacatggagcttcagcaaatgattaacagctcagctc
ttcaaccaaacaaagaggtgttcttccaggttgcagctcagatgttcagtgatggtaaattaaactggggacgcatagtt
gcattattctattttgcctgcaagttggtgatgaaggctttagtgacaaaatttccagaaatggtgaggacaatcatcac
ctggaccattgactacctccatgagcatttgctgaattggatcagggatcagggtggttgggagggaatacggtcatatt
ttggtacacctacctggcagacagtaggtgttttcttagctggagtacttaccacagtacttgtcattcataaaatgtca
tga
© 1998-2023Legal notice