Dataset for CDS Unclassified of Organism Ficedula albicollis

[Download (right click)]

2 sequence(s)

>gnl|bcl2dbcds|A0A803VKQ4_uncBAK1-01 Putative BCL2-antagonist/killer 1 gene OS=[Eukaryota] Ficedula albicollis (length=411 residues).
atgtctcacatcacgagagcccccaggcaatttgtcctctccagctaccccaatgcagcaccagaagaggaaacctacag
taacctccaaacaattccagacaccacagagcaaatggagtttgatatcagctcagctactcaggttggccatcagctgg
ccctgattggggatgaatttaacaggaggtaccacaggacattagaggaaacactgcttcacctggcacgagtggttgct
atcagtgttttccagacatggaatgttattaaaagtgttacaagaagctttgtagatatgagcagtaactggacaaagcg
gatcactggctatggaggctgggtatgctctctcctgtttctcccactttttttggcaagtaggcagcaggaacacctga
ctcccttataa
>gnl|bcl2dbcds|A0A803VKQ4_uncBAK1-02 Putative BCL2-antagonist/killer 1 gene OS=[Eukaryota] Ficedula albicollis (length=447 residues).
atgagtaagatgtctcacatcacgagagcccccaggcaatttgtcctctccagctaccccaatgcagcaccagaagagga
aacctacagtaacctccaaacaattccagacaccacagagcaaatggagtttgatatcagctcagctactcaggttggcc
atcagctggccctgattggggatgaatttaacaggaggtaccacaggacattagaggaaacactgcttcacctggcacga
gtggttgctatcagtgttttccagacatggaatgttattaaaagtgttacaagaagctttgtagatatgagcagtaactg
gacaaagcggatcactggctatggaggctggacttgcaggcttcctgtcaggtgcctctgccagaagctggtgcctgcag
ccttgcttgctgctgccttttggtgggccatgaattatggactgtag
© 1998-2023Legal notice