Dataset for CDS Unclassified of Organism Accipiter nisus

[Download (right click)]

2 sequence(s)

>gnl|bcl2dbcds|A0A8B9NL73_uncBAK1-01 Putative BCL2-antagonist/killer 1 gene OS=[Eukaryota] Accipiter nisus (length=381 residues).
atgtctcaaacaaggagaatccccgggcactttgtcctctccagctaccctaatggagcaccagaagaggaaatctacag
taacctccgaacaatcccagacaccacagagcaaatggagtttaatatcagctcagctacccaggttggccatcagctgg
ccctgatcggggacgaatttaacaggacataccacagaaagcttgaagatacactgcttcacctggcacatggggttgct
atcagtgttttccagacatggactattattaaaagtgttataagaagctttggaaatattttgaacaataactggacaaa
gaggatcattggttatggaagctgggtatgctctctcccttttctcccacctttttgttga
>gnl|bcl2dbcds|A0A8B9RZG2_uncBAX-01 Putative BCL2-associated X gene OS=[Eukaryota] Accipiter nisus (length=840 residues).
atgcctgggttctctgggcagccgtgggtggtggaggggggctccaacacccggatgcctgggtccccacaggcactgtg
gggtgccctgcccctccggaccatcttcgactgggccgtatccttcctgcagcaacgcctctccgcttggatccagcagc
aggggggctggagccgcgttctcgcttcaacagtgcttgaacggaaccggcccgctcccgccccgccgtccgtccgtccg
tctctccgtccatccgtccatccatcccgtcgctgcatcccgccgcgtccgcccaccatggactcccagatccgccagaa
ctaccaccgcgactgcgaggccgccgtcaaccgcatggccaacatggagctccacgcctcctacgtctacctctccatgg
cattctacttcgagcgggacgacgtggcgctgccccgcttgggacgcttcttcttggcgcagtcgcacgaggagcgagaa
cacgccgaggggctgctgcgcttccagacgcgccgtggcggccgtgtgctgctgcaggacgtcaagaagccggagcgtga
tgcttggggctcggcgctggaggcggtggaggcggcgctgcagctggagaagtcggtgaaccaggcgctgctggacctgc
accgcctggctgctgagaagggggacccgcacctctgcgacttcctcgagtcccactacctggacgagcaggtgaaggcc
atcaaggcgctgggagaccacatcaccaacctgcggcgcctggccggggggccggaggggaccccgagcggccttggcga
gtacctcttcgaccgcctcagcctggaggaacgcagctga
© 1998-2023Legal notice