Dataset for CDS BAX of Organism Gouania willdenowi

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C5GYX8_BAX-01      -----atggcagacggtcaccaggaccgggaagagccccgggaccgggaa
A0A8C5ENY4_BAX-01      -----atggca-----tcac----acccgggaggaggcgacgaccaaggc
A0A8C5ENY4_BAX-02      gggcgctggta-----cccc----agtggtcggttggc--------atgc
                             *** *      * *    *   *   *    *            

A0A8C5GYX8_BAX-01      gagcccagaggagccgttggtggacaagatgttgttgatgatcccatcat
A0A8C5ENY4_BAX-01      aatacaaga-------------gaccagatgc-----------------t
A0A8C5ENY4_BAX-02      aatacaaga-------------gaccagatgc-----------------t
                        *  * ***             *** *****                  *

A0A8C5GYX8_BAX-01      ggaacaaggagccgtcgttctcagagggtatgtgattgagcgtattaaca
A0A8C5ENY4_BAX-01      agaagtgggagctgttttattgaaag---atttcattta-----------
A0A8C5ENY4_BAX-02      agaagtgggagctgttttattgaaag---atttcattta-----------
                        ***   ***** **  *  * * **   ** * *** *           

A0A8C5GYX8_BAX-01      ctcaggaccccgcccgccacgtc-tcctctgaggacctggggggggatcc
A0A8C5ENY4_BAX-01      -tcag-----cgactgcagcggcatggtgagaggaaccaggtagtga--c
A0A8C5ENY4_BAX-02      -tcag-----cgactgcagcggcatggtgagaggaaccaggtagtga--c
                        ****     ** * **  ** * *  *  ***** *  **  * **  *

A0A8C5GYX8_BAX-01      aggagaacaacag------------------gacccaaaaatcaaggaag
A0A8C5ENY4_BAX-01      aagagagcagctgggtggctccgagctgtcagaccccaaccacaaaaagc
A0A8C5ENY4_BAX-02      aagagagcagctgggtggctccgagctgtcagaccccaaccacaaaaagc
                       * **** ** * *                  ***** **   ***  *  

A0A8C5GYX8_BAX-01      tggttgagcagcttctgaagattgcagctgacatcaacaggaacgctgag
A0A8C5ENY4_BAX-01      tcggtcagtgcctgcagaagattggagatgagctcgatggaaatgtagag
A0A8C5ENY4_BAX-02      tcggtcagtgcctgcagaagattggagatgagctcgatggaaatgtagag
                       * * * **   ** * ******** ** ***  ** *  * ** *  ***

A0A8C5GYX8_BAX-01      ctccagagactcattaaccaggttcag-----ggtccgtgtgctgaggag
A0A8C5ENY4_BAX-01      ctgcaaaggatgataaac--gacccaaccgtcagtcc---tactaaagac
A0A8C5ENY4_BAX-02      ctgcaaaggatgataaac--gacccaaccgtcagtcc---tactaaagac
                       ** ** **  * ** ***  *   **       ****   * ** * ** 

A0A8C5GYX8_BAX-01      atttttatgggcgtggccagaagtatctttgctgacggca---tcaactg
A0A8C5ENY4_BAX-01      atttttctgagagtagctgttgagatcttctctgatgggaggttcaactg
A0A8C5ENY4_BAX-02      atttttctgagagtagctgttgagatcttctctgatgggaggttcaactg
                       ****** ** * ** **       *****  **** ** *   *******

A0A8C5GYX8_BAX-01      gggtcgagtggtggctctgttccatctggcctacaaactcatctacaagg
A0A8C5ENY4_BAX-01      gggcagagtggttgcacttttctacttcgcctgtcgactcgtcatcaaag
A0A8C5ENY4_BAX-02      gggcagagtggttgcacttttctacttcgcctgtcgactcgtcatcaaag
                       ***  ******* ** ** *** *  * ****    **** **  *** *

A0A8C5GYX8_BAX-01      ctctgaccaccaactgtctggataatataaaaatggtgataaattgggtt
A0A8C5ENY4_BAX-01      ctcttgtaaccaaagttcctgatatcatccgaactattataagttggacc
A0A8C5ENY4_BAX-02      ctcttgtaaccaaagttcctgatatcatccgaactattataagttggacc
                       ****    *****   **  ****  **   **   * **** ****   

A0A8C5GYX8_BAX-01      ctccgtgtggttcgggagcgtctctacatgtggctggtgcagcagggagg
A0A8C5ENY4_BAX-01      atagactacctcagagaacatgtgatcaactggattagagaacagggagg
A0A8C5ENY4_BAX-02      atagactacctcagagaacatgtgatcaactggattagagaacagggagg
                        *        *  * ** * * *   **  *** *     * ********

A0A8C5GYX8_BAX-01      ctgggagggcgt---------catcagcacattctcgagatggaggaccg
A0A8C5ENY4_BAX-01      ctgggagggtattcgttcttacttcggcacccccacg---tggcagacag
A0A8C5ENY4_BAX-02      ctgggagggtattcgttcttacttcggcacccccacg---tggcagacag
                       *********  *         * ** ****   * **   ***  *** *

A0A8C5GYX8_BAX-01      tggccgtagccgcctcgctagtg--ctgatagcatcctttgtttactaca
A0A8C5ENY4_BAX-01      tgggcgt--cttcctggcaggcgttctaacaactgttcttgttatccgta
A0A8C5ENY4_BAX-02      tgggcgt--cttcctggcaggcgttctaacaactgttcttgttatccgta
                       *** ***  *  *** **  * *  ** * * *     *****  *   *

A0A8C5GYX8_BAX-01      gaaagacacgctga
A0A8C5ENY4_BAX-01      agatg------tga
A0A8C5ENY4_BAX-02      agatg------tga
                         * *      ***

© 1998-2023Legal notice