Dataset for CDS BCL-2-like of organism Astyanax mexicanus

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3B1IEV7_MCL1-01      ---atg---------aacccaaccgcgatcagcctcctgtgtgacggaac
A0A3B1JJ42_BCL2L1-      gttatgtcgtactataaccga--------gaattagtggtgtactttatt
A0A3B1K5R1_MCL1-01      atgatg---------agccca--------cag-----gatatgtgttcgt
                           ***         * ** *         *        * *        

A0A3B1IEV7_MCL1-01      aagcccggttctctacagaaccgagaaagaggagaagctgcccc------
A0A3B1JJ42_BCL2L1-      aagtacaaactctcaca--------------gaggaactatcctactaat
A0A3B1K5R1_MCL1-01      a-----------taaca--------------agaagacggcc--------
                        *             ***                    *   *        

A0A3B1IEV7_MCL1-01      -------------------ggacggagcggccggaacgcggcctggaggg
A0A3B1JJ42_BCL2L1-      cacatcggactcatggaagaaacaaatcgaactgaagggggccaggaagc
A0A3B1K5R1_MCL1-01      gacattgttccc----------cgggtcg--ctgttcgcgg--aggaggg
                                              *    **  * *   * **   *** * 

A0A3B1IEV7_MCL1-01      g----------------------------------ctgcagtccgctaa-
A0A3B1JJ42_BCL2L1-      ggaggggaatgcagaggcggccggggtgactcccaccgcagt-cgttaa-
A0A3B1K5R1_MCL1-01      ggagg-------agcggggctctcgctcggtctcgcggccga-cattaga
                        *                                  * ** *  *  **  

A0A3B1IEV7_MCL1-01      -----aggagtctccatgggcggcgggtct----ctgcccgactccccgc
A0A3B1JJ42_BCL2L1-      -----cgggtccgtaaatgg-gacgagtcacggtgcggcagggtcgccca
A0A3B1K5R1_MCL1-01      cctaccaggcccggcgtcgacgacggctca----gtgcccagctccccct
                               *   *      *  * **  **       * *    ** **  

A0A3B1IEV7_MCL1-01      tggcggacgtagacttcatccaggactttagctgccgctgcccgggcgcg
A0A3B1JJ42_BCL2L1-      cctcgtcc----------ccccagagaagggccaacggggctcgg--ggg
A0A3B1K5R1_MCL1-01      tgtcggac----------tgcggggagatggccg-------ttgg--gaa
                           **  *            *  *      **           **  *  

A0A3B1IEV7_MCL1-01      ctggaggcgg---------------agacccgccgcctgatggtg-----
A0A3B1JJ42_BCL2L1-      ctggatgcagt-----------gaaagaggcactgcgggactcagccaac
A0A3B1K5R1_MCL1-01      ctgcaagcagtacgaaacgctggacggagacac-gcgagagattatcagt
                        *** * ** *                **  * * **  **          

A0A3B1IEV7_MCL1-01      gagttttaccgcgggtacctgggc-------cagaagccccgggagcaga
A0A3B1JJ42_BCL2L1-      gagtttgagctgcgatactctcgcg--ccttcagcgacctgt--------
A0A3B1K5R1_MCL1-01      gacttt---ctgaggaacttttgcggactctctcggtcctgtggaggaca
                        ** ***   *   *  **    **       *     **           

A0A3B1IEV7_MCL1-01      --gcccggccctgcggaccatgagccgggtggtggcgggggtcgtcctca
A0A3B1JJ42_BCL2L1-      cctcccagctgcaca--------------------------------tca
A0A3B1K5R1_MCL1-01      cggtgcggttgtacagacaatgaagcgggtggtggacgatctggtggtca
                             * *     *                                 ***

A0A3B1IEV7_MCL1-01      aacacgggatcgcctacaacggtatggtccagaagctgaatttggaggag
A0A3B1JJ42_BCL2L1-      cgcctgctactgcgtaccagag--ctttga-------gagcgtgatggac
A0A3B1K5R1_MCL1-01      aacatgggattgcgtacaaaggtatgttgaacaaactgggtatggaagac
                          *  *  *  ** *** *  *     *         *    **   ** 

A0A3B1IEV7_MCL1-01      caggacgacagtatggacattattagcagcgtagctaaggctctgtttag
A0A3B1JJ42_BCL2L1-      ---------------------------------------gaggtgtttcg
A0A3B1K5R1_MCL1-01      agaggagatgacatgtatgtaattagggcagtagctaaggagctattcag
                                                               *   * **  *

A0A3B1IEV7_MCL1-01      cgacggaaccacgaactgggggcggatcgttagcctggtggcgttcggcg
A0A3B1JJ42_BCL2L1-      cgatggcgt---caactggggccgcgtcgtaggtttgttcgctttcggcg
A0A3B1K5R1_MCL1-01      tgatggcatcaccaactggggcagggtcgccagcctggtggcctttggag
                         ** **       ********  *  ***   *  ** * ** ** ** *

A0A3B1IEV7_MCL1-01      cggtggtgtgtgatcatc------tgaagaagaagagtcgagatcactgc
A0A3B1JJ42_BCL2L1-      gggctctgtgtgtggagtgcgtggagaaggagatgagcc----ccctggt
A0A3B1K5R1_MCL1-01      cagtggtgtccaagcatc------agcatgacatgggccgaggccactgt
                          *   ***      *         * *  * * * * *     *   * 

A0A3B1IEV7_MCL1-01      gtggagaacgtcgcccaacacatctccacctacctcaacacccaccaaca
A0A3B1JJ42_BCL2L1-      gggacg--catcgcagagtggatgaccgtctacttggacaaccacatcca
A0A3B1K5R1_MCL1-01      gtga--------gtctagtgggtgaagaactatcctcatatcttctgtca
                        * *         *   *     *      ***     * * *  *   **

A0A3B1IEV7_MCL1-01      cca--------gtggctcatcaacaacaacgcctgggacggattcgtgga
A0A3B1JJ42_BCL2L1-      gcc--------ctggatccaggagcaaggaggatgggaacgctttgcaga
A0A3B1K5R1_MCL1-01      gacgaaagggactggctcctaaaaaacaaagcatgggatggctttgtgga
                                    *** **    *  *    *  *****  * ** *  **

A0A3B1IEV7_MCL1-01      attcttccgcgaggacgactcagaatcacgagtccgaa--acgccctgat
A0A3B1JJ42_BCL2L1-      gatctttggga---acgacacagcagcagagagcagaaggatgcaggaac
A0A3B1K5R1_MCL1-01      gttttttcgtgttcctgatcctgagtcaacgatgagaa--atgcattaat
                          * **  *       **  * *   **       ***  * **    * 

A0A3B1IEV7_MCL1-01      g---------------------------gccttcgctggatttgccgggc
A0A3B1JJ42_BCL2L1-      gctataagatgtggctgctggtggggatgaccctg-----ttcacaggaa
A0A3B1K5R1_MCL1-01      g---------------------------gcctttg-----tt-------a
                        *                           * *   *     **        

A0A3B1IEV7_MCL1-01      tgggggcggg--------------gctagcactactgatgcgctga
A0A3B1JJ42_BCL2L1-      ttgtggtgggctctctcatcgctcagaagcgtct--------gtaa
A0A3B1K5R1_MCL1-01      ctgtggcagg-tcttggagc-ctcaatagcatttttggcaagataa
                          * **  **                 ***             * *

© 1998-2022Legal notice