Dataset for CDS BCL-2-like of organism Astyanax mexicanus

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3B1IEV7_MCL1-01      atgaac------ccaaccgcgatcagcctcctgtgtg---acgga-----
A0A3B1JJ42_BCL2L1-      gtt-atgtcgtactataaccgagaa------ttagtg---gtgtacttta
A0A8B9LKW7_BCL2L1-      ----atgtcgtactataaccgagaa------ttagtg---gtgtacttta
A0A3B1K5R1_MCL1-01      atg-atg-------agcccacagga------tatgtgttcgtata-----
A0A8B9JW80_MCL1-01      atgcatatttttctaagccacaacg------t--------gcaga-----
                            *         *      *         *            *     

A0A3B1IEV7_MCL1-01      ------acaagcccggttctctacagaaccgagaaagaggagaagctgcc
A0A3B1JJ42_BCL2L1-      ttaagtacaaactc---tcacagaggaactatcctactaatcacatcgga
A0A8B9LKW7_BCL2L1-      ttaagtacaaactc---tcacagaggaactatcctactaatcacatcgga
A0A3B1K5R1_MCL1-01      ------acaag------------aag---------acggccgacattgtt
A0A8B9JW80_MCL1-01      ------acgagact---cggtttaag---------accgtcgacattgtt
                              ** *               *         *      *    *  

A0A3B1IEV7_MCL1-01      ccg--------gacggagcggccggaacgcggcctggagggg--------
A0A3B1JJ42_BCL2L1-      ctcatggaagaaacaaatcgaactgaagggggccaggaagcggaggggaa
A0A8B9LKW7_BCL2L1-      ctcgtggaagaaacaaatcgaactgaagggggccaggaagcggaggggaa
A0A3B1K5R1_MCL1-01      ccc----------cgggtcg--ctgttcgcgg--aggagggggagg----
A0A8B9JW80_MCL1-01      ccc----------cgggtcg--ctgttcgcgg--aggagggggagg----
                        *            *    **  * *   * **   *** * *        

A0A3B1IEV7_MCL1-01      --------------------------ctgcagtccgctaa------agga
A0A3B1JJ42_BCL2L1-      tgcagaggcggccggggtgactcccaccgcagt-cgttaa------cggg
A0A8B9LKW7_BCL2L1-      cgcagaggcggccgcggtgactcccaccgcagt-cgttaa------cggg
A0A3B1K5R1_MCL1-01      ---agcggggctctcgctcggtctcgcggccga-cattagacctaccagg
A0A8B9JW80_MCL1-01      ---agcggggctctcgctcggtctcgcggccga-cattagacctaccagg
                                                  * ** *  *  **         * 

A0A3B1IEV7_MCL1-01      gtctccatgggcggcgggtct----ctgcccgactccccgctggcggacg
A0A3B1JJ42_BCL2L1-      tccgtaaatgg-gacgagtcacggtgcggcagggtcgcccacctcgtcc-
A0A8B9LKW7_BCL2L1-      tccgtaaatgg-gacgagtcacggtgcggcagggtcgcccacctcgtcc-
A0A3B1K5R1_MCL1-01      cccggcgtcgacgacggctca----gtgcccagctcccccttgtcggac-
A0A8B9JW80_MCL1-01      cccggcgtcgacgacggctca----gtgcccagctcccccttgtcggac-
                          *      *  * **  **       * *    ** **     **  * 

A0A3B1IEV7_MCL1-01      tagacttcatccaggactttagctgccgctgcccgggcgcgctggaggcg
A0A3B1JJ42_BCL2L1-      ---------ccccagagaagggccaacggggctcgg--gggctggatgca
A0A8B9LKW7_BCL2L1-      ---------ccccagagaagggccaacggggctcgg--gggctggatgca
A0A3B1K5R1_MCL1-01      ---------tgcggggagatggccg-------ttgg--gaactgcaagca
A0A8B9JW80_MCL1-01      ---------tgcggggagatggccg-------ttgg--gaactgcaagca
                                   *  *      **           **  *  *** * ** 

A0A3B1IEV7_MCL1-01      g---------------agacccgccgcctgatggtg-----gagttttac
A0A3B1JJ42_BCL2L1-      gt-----------gaaagaggcactgcgggactcagccaacgagtttgag
A0A8B9LKW7_BCL2L1-      gt-----------gaaagaggcactgcgggactcagccaacgagtttgag
A0A3B1K5R1_MCL1-01      gtacgaaacgctggacggagacac-gcgagagattatcagtgacttt---
A0A8B9JW80_MCL1-01      gtacgaaacgctggacggagacac-gcgagagattatcagtgacttt---
                        *                **  * * **  **          ** ***   

A0A3B1IEV7_MCL1-01      cgcgggtacctgggc-------cagaagccccgggagcaga--gcccggc
A0A3B1JJ42_BCL2L1-      ctgcgatactctcgcg--ccttcagcgacctgt--------cctcccagc
A0A8B9LKW7_BCL2L1-      ctgcgatactctcgcg--ccttcagcgacctgt--------cctcccagc
A0A3B1K5R1_MCL1-01      ctgaggaacttttgcggactctctcggtcctgtggaggacacggtgcggt
A0A8B9JW80_MCL1-01      ctgaggaacttttgcggactctctcggtcctgtggaggacacggtgcggt
                        *   *  **    **       *     **                * * 

A0A3B1IEV7_MCL1-01      cctgcggaccatgagccgggtggtggcgggggtcgtcctcaaacacggga
A0A3B1JJ42_BCL2L1-      tgcaca--------------------------------tcacgcctgcta
A0A8B9LKW7_BCL2L1-      tgcaca--------------------------------tcacgcctgcta
A0A3B1K5R1_MCL1-01      tgtacagacaatgaagcgggtggtggacgatctggtggtcaaacatggga
A0A8B9JW80_MCL1-01      tgtacagacaatgaagcgggtggtggacgatctggtggtcaaacatggga
                            *                                 ***  *  *  *

A0A3B1IEV7_MCL1-01      tcgcctacaacggtatggtccagaagctgaatttggaggagcaggacgac
A0A3B1JJ42_BCL2L1-      ctgcgtaccagagct-----------------------------------
A0A8B9LKW7_BCL2L1-      ctgcgtaccagagct-----------------------------------
A0A3B1K5R1_MCL1-01      ttgcgtacaaaggtatgttgaacaaactgggtatggaagacagaggagat
A0A8B9JW80_MCL1-01      ttgcgtacaaaggttggttagcttatct---------------aagagat
                          ** *** *  *                                     

A0A3B1IEV7_MCL1-01      agtatggacattattagcagcgtagctaaggctctgtttagcgacggaac
A0A3B1JJ42_BCL2L1-      -------------ttgagagcgtgatggacgaggtgtttcgcgatggcgt
A0A8B9LKW7_BCL2L1-      -------------ttgagagcgtgatggacgaggtgtttcgcgatggcgt
A0A3B1K5R1_MCL1-01      gacatgtatgtaattagggcagtagctaaggagctattcagtgatggcat
A0A8B9JW80_MCL1-01      gacatgtatgtaattagggcagtagctaaggagctattcagtgatggcat
                                     **      **     * *   * **  * ** **   

A0A3B1IEV7_MCL1-01      cacgaactgggggcggatcgttagcctggtggcgttcggcgcggtggtgt
A0A3B1JJ42_BCL2L1-      ---caactggggccgcgtcgtaggtttgttcgctttcggcggggctctgt
A0A8B9LKW7_BCL2L1-      ---caactggggccgcgtcgtaggtttgttcgctttcggcggggctctgt
A0A3B1K5R1_MCL1-01      caccaactggggcagggtcgccagcctggtggcctttggagcagtggtgt
A0A8B9JW80_MCL1-01      caccaactggggcagggtcgccagcctggtggcctttggagcagtggtgt
                            ********  *  ***   *  ** * ** ** ** *  *   ***

A0A3B1IEV7_MCL1-01      gtgatcatc------tgaagaagaagagtcgagatcactgcgtggagaac
A0A3B1JJ42_BCL2L1-      gtgtggagtgcgtggagaaggagatgagcc----ccctggtgggacg--c
A0A8B9LKW7_BCL2L1-      gtgtggagtgcgtggagaaggagatgagcc----ccctggtgggacg--c
A0A3B1K5R1_MCL1-01      ccaagcatc------agcatgacatgggccgaggccactgtgtga-----
A0A8B9JW80_MCL1-01      ccaagcatc------agcatgacatgggccgaggccactgtgtga-----
                              *         * *  * * * * *     *   * * *      

A0A3B1IEV7_MCL1-01      gtcgcccaacacatctccacctacctcaacacccaccaacacca------
A0A3B1JJ42_BCL2L1-      atcgcagagtggatgaccgtctacttggacaaccacatccagcc------
A0A8B9LKW7_BCL2L1-      atcgcagagtggatgaccgtctacttggacaaccacatccagcc------
A0A3B1K5R1_MCL1-01      ---gtctagtgggtgaagaactatcctcatatcttctgtcagacgaaagg
A0A8B9JW80_MCL1-01      ---gtctagtgggtgaagaactatcctcatatcttctgtcagacgaaagg
                           *   *     *      ***     * * *  *   **         

A0A3B1IEV7_MCL1-01      --gtggctcatcaacaacaacgcctgggacggattcgtggaattcttccg
A0A3B1JJ42_BCL2L1-      --ctggatccaggagcaaggaggatgggaacgctttgcagagatctttgg
A0A8B9LKW7_BCL2L1-      --ctggatccaggagcaaggaggatgggaacgctttgcagagatctttgg
A0A3B1K5R1_MCL1-01      gactggctcctaaaaaacaaagcatgggatggctttgtggagttttttcg
A0A8B9JW80_MCL1-01      gactggctcctaaaaaacaaagcatgggatggctttgtggagttttttcg
                           *** **    *  *    *  *****  * ** *  **  * **  *

A0A3B1IEV7_MCL1-01      cgaggacgactcagaatcacgagtccgaa--acgccctgatg--------
A0A3B1JJ42_BCL2L1-      ga---acgacacagcagcagagagcagaaggatgcaggaacgctataaga
A0A8B9LKW7_BCL2L1-      ga---acgacacagcagcagagagcagaaggatgcaggaacgctataaga
A0A3B1K5R1_MCL1-01      tgttcctgatcctgagtcaacgatgagaa--atgcattaatg--------
A0A8B9JW80_MCL1-01      tgttcctgatcctgagtcaacgatgagaa--atgcattaatg--------
                               **  * *   **       ***  * **    * *        

A0A3B1IEV7_MCL1-01      -------------------gccttcgctggatttgccgggctgggggcgg
A0A3B1JJ42_BCL2L1-      tgtggctgctggtggggatgaccctg-----ttcacaggaattgtggtgg
A0A8B9LKW7_BCL2L1-      tgtggctgctggtggggatgaccctg-----ttcacaggaattgtggtgg
A0A3B1K5R1_MCL1-01      -------------------gcctttg-----tt-------actgtggcag
A0A8B9JW80_MCL1-01      -------------------gcctttg-----tt-------actgtggcag
                                           * *   *     **          * **  *

A0A3B1IEV7_MCL1-01      g--------------gctagcactactgatgcgctga
A0A3B1JJ42_BCL2L1-      gctctctcatcgctcagaagcgtct--------gtaa
A0A8B9LKW7_BCL2L1-      gctctctcatcgctcagaagcgtct--------gtaa
A0A3B1K5R1_MCL1-01      g-tcttggagc-ctcaatagcatttttggcaagataa
A0A8B9JW80_MCL1-01      g-tcttggagc-ctcaatagcatttttggcaagataa
                        *                 ***             * *

© 1998-2022Legal notice