Dataset for CDS BCL2L2 of organism Ictidomys tridecemlineatus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A287D9B3_BCL2L2-      atggcgaccccagcctcggccccagacacacgggctctggtggccgactt
A0A287D9B3_BCL2L2-      atggcgaccccagcctcggccccagacacacgggctctggtggccgactt

A0A287D9B3_BCL2L2-      tgtaggctataagctgaggcagaagggttacgtctgtggagctggccctg
A0A287D9B3_BCL2L2-      tgtaggctataagctgaggcagaagggttacgtctgtggagctggccctg

A0A287D9B3_BCL2L2-      gggagggcccagcagctgatccactgcaccaagccatgcgggcagctgga
A0A287D9B3_BCL2L2-      gggagggcccagcagctgatccactgcaccaagccatgcgggcagctgga

A0A287D9B3_BCL2L2-      gatgagttcgagacccgcttccggcgcaccttctctgatctggcagctca
A0A287D9B3_BCL2L2-      gatgagttcgagacccgcttccggcgcaccttctctgatctggcagctca

A0A287D9B3_BCL2L2-      gctgcatgtgaccccgggttcagctcagcaacgcttcacccaggtctctg
A0A287D9B3_BCL2L2-      gctgcatgtgaccccgggttcagctcagcaacgcttcacccaggtctctg

A0A287D9B3_BCL2L2-      acgaacttttccaagggggtcccaactggggtcgtcttgtggccttcttt
A0A287D9B3_BCL2L2-      acgaacttttccaagggggtcccaactggggtcgtcttgtggccttcttt

A0A287D9B3_BCL2L2-      gtctttggggctgccctgtgtgctgagagtgtcaacaaagagatggagcc
A0A287D9B3_BCL2L2-      gtctttggggctgccctgtgtgctgagagtgtcaacaaagagatggagcc

A0A287D9B3_BCL2L2-      actggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
A0A287D9B3_BCL2L2-      actggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc

A0A287D9B3_BCL2L2-      tggctgactggatccacagcagtgggggctgggcggagttcacagctcta
A0A287D9B3_BCL2L2-      tggctgactggatccacagcagtgggggctgg----------ctgttctc
                        ********************************          * * *** 

A0A287D9B3_BCL2L2-      tacggggac----ggggccctggaggaggcacggcgtctgcgggagggga
A0A287D9B3_BCL2L2-      cagggggaatatgggggctctga-------ttggaggctgggacagctgt
                         * *****     ***** ***          ** * *** *  **  * 

A0A287D9B3_BCL2L2-      actgggcatcagtgaggacagtgctgacgggggccgtggcactgggggcc
A0A287D9B3_BCL2L2-      gctgggaa---------------------ggaggcatggggctga-----
                         ***** *                     ** * * ***  ***      

A0A287D9B3_BCL2L2-      ctggtaactgtaggggccttttttgctagcaagtga
A0A287D9B3_BCL2L2-      ------------------------------------

© 1998-2021Legal notice