Dataset for CDS BAX-like of Organism Balaenoptera musculus

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C0HZI3_BOK-01       atggaggtgctgcggcgctc-------ctcggtcttcgccgccga-----
A0A8C0D3A6_BAK1-01      atggcatccggacaagg----------cccagg--tcctcccaga-----
A0A8C0D3A6_BAK1-02      atggcatccggacaagg----------cccagg--tcctcccaga-----
A0A8B8VVQ4_BAX-01       atga-----agacaggggcccttttgcttcagggtttcatccaggatcga
A0A8B8VVQ4_BAX-02       atg-------gacggg-----------tccggggagcaacccaga-----
                        ***         *                * *         * *      

A0A8C0HZI3_BOK-01       -----------gatcatggacgcctttgaccgctcgcccaccgacaagga
A0A8C0D3A6_BAK1-01      ---------caggggtgcgaagaacctgacccctcctccacttcggagga
A0A8C0D3A6_BAK1-02      ---------caggggtgcgaagaacctgacccctcctccacttcggagga
A0A8B8VVQ4_BAX-01       gcagggcgaatggggggagagacacccgagctgggcct---------gga
A0A8B8VVQ4_BAX-02       -----------ggcggggggcccacc-------agctc---------tga
                                   *      *                             **

A0A8C0HZI3_BOK-01       gctggtggctcaggccaaggcgcttggccgggagttcgtgcacgcgcggc
A0A8C0D3A6_BAK1-01      gcaggtagcccgggac------acgg---aggaggttttccgcagctacg
A0A8C0D3A6_BAK1-02      gcaggtagcccgggac------acgg---aggaggttttccgcagctacg
A0A8B8VVQ4_BAX-01       gcaggcgccccaggatgcatccacca---agaag-------ctgagcgag
A0A8B8VVQ4_BAX-02       gcag------------------atca---tgaag-------acaggggcc
                        ** *                          * **                

A0A8C0HZI3_BOK-01       tgctgcgcgccggcctcgcctggagcgcgccggagcgcgccacgcccgcc
A0A8C0D3A6_BAK1-01      tcttttaccgccatcag------------caggagcagga----------
A0A8C0D3A6_BAK1-02      tcttttaccgccatcag------------caggagcagga----------
A0A8B8VVQ4_BAX-01       tgtctcaagcgcattggagatgaactggacagtaacatgg----------
A0A8B8VVQ4_BAX-02       ctttt---------------------------------------------
                                                                          

A0A8C0HZI3_BOK-01       cccggcggccgcctggccgaagtgtgcgcggtgctgctgcgcctggcgga
A0A8C0D3A6_BAK1-01      --------------ggccg-agggggcg-------gccgcgccca-----
A0A8C0D3A6_BAK1-02      --------------ggccg-agggggcg-------gccgcgccca-----
A0A8B8VVQ4_BAX-01       --------------agctgcagaggatg-------atcgcggccg-----
A0A8B8VVQ4_BAX-02       ---------------gcttcaggggatg-------atcgcggccg-----
                                       **   ** *   *          *** *       

A0A8C0HZI3_BOK-01       cgagctggagctgatccggcccagcgtctaccgcaacgtggcccgccagc
A0A8C0D3A6_BAK1-01      ---------------cagacccaga---------aatg------------
A0A8C0D3A6_BAK1-02      ---------------cagacccaga---------aatg------------
A0A8B8VVQ4_BAX-01       ---------------tggacacagactccccccgagag------------
A0A8B8VVQ4_BAX-02       ---------------tggacacagactccccccgagag------------
                                         * * ***          *  *            

A0A8C0HZI3_BOK-01       tgaacatctccctgcagtccgagaccgtggtgaccgacgccttcctggct
A0A8C0D3A6_BAK1-01      --------------------------------------gtcacctt----
A0A8C0D3A6_BAK1-02      --------------------------------------gtcacctt----
A0A8B8VVQ4_BAX-01       --------------------------------------gtctttttccga
A0A8B8VVQ4_BAX-02       --------------------------------------gtctttttccga
                                                              * *    *    

A0A8C0HZI3_BOK-01       gtggcagcccagatcttttctgcaggaatc---acctggggcaaggtcgt
A0A8C0D3A6_BAK1-01      ---gtccctagaa-----cctagcagcacc-----atggggcaggtgggt
A0A8C0D3A6_BAK1-02      ---gtccctagaa-----cctagcagcacc-----atggggcaggtgggt
A0A8B8VVQ4_BAX-01       gtggcggctgaaatgttttctgacggcaacttcaactggggccgggttgt
A0A8B8VVQ4_BAX-02       gtggcggctgaaatgttttctgacggcaacttcaactggggccgggttgt
                           *   *    *      **    * * *      ******  *   **

A0A8C0HZI3_BOK-01       gtccctgtactcagtggctgcgg--------------ggctggccgt--g
A0A8C0D3A6_BAK1-01      cgcc-------agctggccatcatcggggatgacatcaaccggcgct-ac
A0A8C0D3A6_BAK1-02      cgcc-------agctggccatcatcggggatgacatcaaccggcgct-ac
A0A8B8VVQ4_BAX-01       cgcccttttctactttgccagca--------------aactggtgctcaa
A0A8B8VVQ4_BAX-02       cgcccttttctactttgccagca--------------aactggtgctcaa
                          **          * **                     * **   *   

A0A8C0HZI3_BOK-01       gactgcgtgcgacaggccca---gcccgccctggtcca-cgccctcgtgg
A0A8C0D3A6_BAK1-01      gactccgagttccaggccatgttgcagcacctg--cagccaacagcagag
A0A8C0D3A6_BAK1-02      gactccgagttccaggccatgttgcagcacctg--cagccaacagcagag
A0A8B8VVQ4_BAX-01       ggccctgtgc-----accaaggtgccccagctgatcag-gaccatcatgg
A0A8B8VVQ4_BAX-02       ggccctgtgc-----accaaggtgccccagctgatcag-gaccatcatgg
                        * *   * *       **     **     ***  *      *  *   *

A0A8C0HZI3_BOK-01       actgcctcggggagttcgtgcgcaagaccctggcgacctggctgcggaga
A0A8C0D3A6_BAK1-01      aacgcctacgagtatttcaccaagattgcctca-----------------
A0A8C0D3A6_BAK1-02      aacgcctacgagtatttcaccaagattgcctcaaggccagcagcaatgcc
A0A8B8VVQ4_BAX-01       gctggacactggacttccttcgagagcggctgctgggctggatccaggac
A0A8B8VVQ4_BAX-02       gctggacactggacttccttcgagagcggctgctgggctggatccaggac
                           *       *  **    *   *    **                   

A0A8C0HZI3_BOK-01       cgcggtggatggacggatgtgctcaagtgcgtggtcagcaccgaccccgg
A0A8C0D3A6_BAK1-01      ---ag------------cctgtttgagagcggcatcaac--------tgg
A0A8C0D3A6_BAK1-02      cacag------------cctgtttgagagcggcatcaac--------tgg
A0A8B8VVQ4_BAX-01       c--ag------------ggtggttggga-cggcctcctctcctactttgg
A0A8B8VVQ4_BAX-02       c--ag------------ggtggttggga-cggcctcctctcctactttgg
                            *              ** *   *  **   **  *         **

A0A8C0HZI3_BOK-01       cctccgctcgcactggctcgtggccgcgctctgcggc---ttcggccgct
A0A8C0D3A6_BAK1-01      ggc----------cgagtggtggc--t-ctgctgggc---tttggctacc
A0A8C0D3A6_BAK1-02      ggc----------cgagtggtggc--t-ctgctgggc---tttggctacc
A0A8B8VVQ4_BAX-01       gacacccacgtggcagacagtgaccat-cttcgtggccggcgtgctcact
A0A8B8VVQ4_BAX-02       gacacccacgtggcagacagtgaccat-cttcgtggccggcgtgctcact
                                           *** *    **    ***      *    * 

A0A8C0HZI3_BOK-01       tcctgaaggctgcattcttcatgctgctgccggagagatga---------
A0A8C0D3A6_BAK1-01      gcct--------ggccctccacgtctaccagcacggcctgactggcttcc
A0A8C0D3A6_BAK1-02      gcct--------ggccctccacgtctaccagcacggcctga---------
A0A8B8VVQ4_BAX-01       gcct--------cgcttaccatctggaagaagatgggctga---------
A0A8B8VVQ4_BAX-02       gcct--------cgcttaccatctggaagaagatgggctga---------
                         ***               **             *   ***         

A0A8C0HZI3_BOK-01       --------------------------------------------------
A0A8C0D3A6_BAK1-01      tgggccaggtgacccgcttcgtggccgacttcatgttgcatcactgcatt
A0A8C0D3A6_BAK1-02      --------------------------------------------------
A0A8B8VVQ4_BAX-01       --------------------------------------------------
A0A8B8VVQ4_BAX-02       --------------------------------------------------
                                                                          

A0A8C0HZI3_BOK-01       --------------------------------------------------
A0A8C0D3A6_BAK1-01      gcccggtggatcgcacagagaggtggctgggtggcagccctggacttggg
A0A8C0D3A6_BAK1-02      --------------------------------------------------
A0A8B8VVQ4_BAX-01       --------------------------------------------------
A0A8B8VVQ4_BAX-02       --------------------------------------------------
                                                                          

A0A8C0HZI3_BOK-01       --------------------------------------------------
A0A8C0D3A6_BAK1-01      aaacggccccatctggaatgtgctgatagttctggctgtggttttgttgg
A0A8C0D3A6_BAK1-02      --------------------------------------------------
A0A8B8VVQ4_BAX-01       --------------------------------------------------
A0A8B8VVQ4_BAX-02       --------------------------------------------------
                                                                          

A0A8C0HZI3_BOK-01       -----------------------------------
A0A8C0D3A6_BAK1-01      gccagtttgtggtacgaagatttttcaagtcatga
A0A8C0D3A6_BAK1-02      -----------------------------------
A0A8B8VVQ4_BAX-01       -----------------------------------
A0A8B8VVQ4_BAX-02       -----------------------------------
                                                           

© 1998-2023Legal notice