Dataset for CDS BCL-2-like of organism Oryzias javanicus

[Download (right click)] [Edit] [Sequences] [Repertoires]

7 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A437DD16_BCL2L1-      atgtcccactgta-------------------------------------
A0A437D660_BCL2L1-      atgtcccgca----------------------------------------
A0A437D660_BCL2L1-      atgtcccgca----------------------------------------
A0A3S2PV78_BCL2-01      --------------------------------------------------
A0A3S2PV78_BCL2-02      --------------------------------------------------
A0A3S2PV78_BCL2-03      atgtcctctaaagaaggcttcagttcagctgtcaccgattggcttttcat
A0A3S2PV78_BCL2-04      atgtcctctaaagaaggcttcagttcagctgtcaccgattggcttttcat
                                                                          

A0A437DD16_BCL2L1-      ----------------------------------------acagagagct
A0A437D660_BCL2L1-      ----------------------------------------acagagaac-
A0A437D660_BCL2L1-      ----------------------------------------acagagaac-
A0A3S2PV78_BCL2-01      ----------------------------------------atggcgaacg
A0A3S2PV78_BCL2-02      -------------------------------atgctcctgatagtggtcg
A0A3S2PV78_BCL2-03      caattcctggtggatcctgctgccttttattatgctcctgatagtggtcg
A0A3S2PV78_BCL2-04      caattcctggtggatcctgctgccttttattatgctcctgatagtggtcg
                                                                *  * *  * 

A0A437DD16_BCL2L1-      ggtgcagttctatt-----------taggctataagatgtcgtccagaga
A0A437D660_BCL2L1-      ----tggttgttttctacg------tgaagtataaactgtctcagaggaa
A0A437D660_BCL2L1-      ----tggttgttttctacg------tgaagtataaactgtctcagaggaa
A0A3S2PV78_BCL2-01      tgtctcatcgcag------------tattgtagaaaa-------g-----
A0A3S2PV78_BCL2-02      cct-tcattgttgccttcgtgttgctgctgtacatgatatcgccg-----
A0A3S2PV78_BCL2-03      cct-tcattgttgccttcgtgttgctgctgtacatgatatcgccg-----
A0A3S2PV78_BCL2-04      cct-tcattgttgccttcgtgttgctgctgtacatgatatcgccg-----
                               *                 *    ** *                

A0A437DD16_BCL2L1-      ctatcctgt---------------------gtccctgctg-------aag
A0A437D660_BCL2L1-      ctaccccctcaaccacatagtgctcaatgagtctccgaac-------agg
A0A437D660_BCL2L1-      ctaccccctcaaccacatagtgctcaatgagtctccgaac-------agg
A0A3S2PV78_BCL2-01      ----tacatttgccaca-----------aactctccaaga-------ggg
A0A3S2PV78_BCL2-02      ----ctcattagtc-ca-----------aagcctctgaaattaaacgggg
A0A3S2PV78_BCL2-03      ----ctcattagtc-ca-----------aagcctctgaaattaaacgggg
A0A3S2PV78_BCL2-04      ----ctcattagtc-ca-----------aagcctctgaaattaaacgggg
                                *                       * *              *

A0A437DD16_BCL2L1-      cccacag-------------------------atgatgggggacaaactg
A0A437D660_BCL2L1-      actgctg---------cggagg---aggtgg----gcgaggagcagagca
A0A437D660_BCL2L1-      actgctg---------cggagg---aggtgg----gcgaggagcagagca
A0A3S2PV78_BCL2-01      gctacgt--------------gttcggcttggacggcggccagca---cg
A0A3S2PV78_BCL2-02      cccacgtcgtggtgaccggaggctcaggtggaattgggaaaagcattgcg
A0A3S2PV78_BCL2-03      cccacgtcgtggtgaccggaggctcaggtggaattgggaaaagcattgcg
A0A3S2PV78_BCL2-04      cccacgtcgtggtgaccggaggctcaggtggaattgggaaaagcattgcg
                         *  *                                *     **     

A0A437DD16_BCL2L1-      aagag-------------------------------gaccgctc------
A0A437D660_BCL2L1-      cagagacgcacgccaa------------------cgggacgttta-----
A0A437D660_BCL2L1-      cagagacgcacgccaa------------------cgggacgttta-----
A0A3S2PV78_BCL2-01      a--ggatgc-cgctaataa---------------cggctcgctcg-----
A0A3S2PV78_BCL2-02      atcgaatgc-ttcagacaaggagcctttatcactctggttgctcgtgatg
A0A3S2PV78_BCL2-03      atcgaatgc-ttcagacaaggagcctttatcactctggttgctcgtgatg
A0A3S2PV78_BCL2-04      atcgaatgc-ttcagacaaggagcctttatcactctggttgctcgtgatg
                                                            *   * *       

A0A437DD16_BCL2L1-      --------------------------------------------------
A0A437D660_BCL2L1-      --------------------------------------------------
A0A437D660_BCL2L1-      --------------------------------------------------
A0A3S2PV78_BCL2-01      --------------------------------------------------
A0A3S2PV78_BCL2-02      aggataaattactcaaagcaaagaaggaggtggagaagttcgcaatcaat
A0A3S2PV78_BCL2-03      aggataaattactcaaagcaaagaaggaggtggagaagttcgcaatcaat
A0A3S2PV78_BCL2-04      --------------------------------------------------
                                                                          

A0A437DD16_BCL2L1-      -----------------------------cgctgtctgcaatggcacgct
A0A437D660_BCL2L1-      -----------------------acgggacg--agtcccggtaccccgcc
A0A437D660_BCL2L1-      -----------------------acgggacg--agtcccggtaccccgcc
A0A3S2PV78_BCL2-01      -------------------gtg-accgttccccgactccggtccgccgcc
A0A3S2PV78_BCL2-02      gacaaacaggtggtgttgtgtgtatcggtcgacatctccagt--gattac
A0A3S2PV78_BCL2-03      gacaaacaggtggtgttgtgtgtatcggtcgacatctccagt--gattac
A0A3S2PV78_BCL2-04      -------aggtggtgttgtgtgtatcggtcgacatctccagt--gattac
                                                     *        *  *        

A0A437DD16_BCL2L1-      ggttaacagtgaggacg------accag---ctgaagaagtcctgcccct
A0A437D660_BCL2L1-      gct---------gtccccgttacgacagcagcagttgccgccgtcgac--
A0A437D660_BCL2L1-      gct---------gtccccgttacgacagcagcagttgccgccgtcgac--
A0A3S2PV78_BCL2-01      gctgcgacgcgggaacggggcctgacgg---cgagcgcagccc---cc--
A0A3S2PV78_BCL2-02      act-caagtggaaaatgtgataaaacaggctcaagagaagctcggacc--
A0A3S2PV78_BCL2-03      act-caagtggaaaatgtgataaaacaggctcaagagaagctcggacc--
A0A3S2PV78_BCL2-04      act-caagtggaaaatgtgataaaacaggctcaagagaagctcggacc--
                          *                      * *   *    *  *       *  

A0A437DD16_BCL2L1-      gttgtaatagcatggatgccatca--aatccacccttaaagatt------
A0A437D660_BCL2L1-      ----gacaaacatggacgcagtgaaggaggcgctccgggaca--------
A0A437D660_BCL2L1-      ----gacaaacatggacgcagtgaaggaggcgctccgggaca--------
A0A3S2PV78_BCL2-01      ----gcctcatccgcgcgc-----tggagccgcacgcggacatccacaga
A0A3S2PV78_BCL2-02      ----agttgatatgctcgt-------gaactgcgctggaacagccgtcgc
A0A3S2PV78_BCL2-03      ----agttgatatgctcgt-------gaactgcgctggaacagccgtcgc
A0A3S2PV78_BCL2-04      ----agttgatatgctcgt-------gaactgcgctggaacagccgtcgc
                                     *   *         *    * *    * *        

A0A437DD16_BCL2L1-      ------cggccgac-------gagtttgaacgtcgcttctatcaaggt--
A0A437D660_BCL2L1-      ------cggccaac-------gagttcgagctgcggtacgccctggcc--
A0A437D660_BCL2L1-      ------cggccaac-------gagttcgagctgcggtacgccctggcc--
A0A3S2PV78_BCL2-01      gtcctgcgggaggctggagacgagctggagcggctgtaccagcgggac--
A0A3S2PV78_BCL2-02      ------tgggaagtttgag--gagatggag-----------gtggaacgt
A0A3S2PV78_BCL2-03      ------tgggaagtttgag--gagatggag-----------gtggaacgt
A0A3S2PV78_BCL2-04      ------tgggaagtttgag--gagatggag-----------gtggaacgt
                               **            *** * **                     

A0A437DD16_BCL2L1-      tttagtgatctctctgtgcaacttcacat---------------------
A0A437D660_BCL2L1-      ttcaacaacctgcacagccagctgcacat---------------------
A0A437D660_BCL2L1-      ttcaacaacctgcacagccagctgcacat---------------------
A0A3S2PV78_BCL2-01      ttcacggagatgtcgcggcagctgtacct---------------------
A0A3S2PV78_BCL2-02      ttcaaagagttgatggaggtgaattacctgggcagcgtctacccaacacg
A0A3S2PV78_BCL2-03      ttcaaagagttgatggaggtgaattacctgggcagcgtctacccaacacg
A0A3S2PV78_BCL2-04      ttcaaa--------------------------------------------
                        ** *                                              

A0A437DD16_BCL2L1-      ---cactcctgacacagcataccaaaacttcaaaagtgtgttgg------
A0A437D660_BCL2L1-      ---cacgcccgccacggcctaccagagcttcgagaacgtgatga------
A0A437D660_BCL2L1-      ---cacgcccgccacggcctaccagagcttcgagaacgtgatga------
A0A3S2PV78_BCL2-01      ---cacctccaccacggcgaagacccggttcgccgaggtgatcg------
A0A3S2PV78_BCL2-02      agccgtcataaccaccatgaaggagcggagaatgggtcggatcgtgttcg
A0A3S2PV78_BCL2-03      agccgtcataaccaccatgaaggagcggagaatgggtcggatcgtgttcg
A0A3S2PV78_BCL2-04      --------------------------------------------------
                                                                          

A0A437DD16_BCL2L1-      ---------------------atgagctgttcaaggatgggataaac---
A0A437D660_BCL2L1-      ---------------------acgagctgttccgcgacaacatcaac---
A0A437D660_BCL2L1-      ---------------------acgagctgttccgcgacaacatcaac---
A0A3S2PV78_BCL2-01      ---------------------acgaactgttccgggacggggtgaac---
A0A3S2PV78_BCL2-02      tctcctcccagtttgctctgcgcggatt------------ggcggaatcg
A0A3S2PV78_BCL2-03      tctcctcccaggcgggacagatcggccttttcggatatacggcttactct
A0A3S2PV78_BCL2-04      --------------------------------------------------
                                                                          

A0A437DD16_BCL2L1-      -------------------tgggggcg--------------tgttgtggg
A0A437D660_BCL2L1-      -------------------tggggccg--------------catcgtggg
A0A437D660_BCL2L1-      -------------------tggggccg--------------catcgtggg
A0A3S2PV78_BCL2-01      -------------------tggggccg--------------gattatcgc
A0A3S2PV78_BCL2-02      ctgcaaa------tggagatgaagccgtacaacatctatgtgactgtggc
A0A3S2PV78_BCL2-03      ccttcaagtttgctctgcatgaagccgtacaacatctatgtgactgtggc
A0A3S2PV78_BCL2-04      --------------------------------------------------
                                                                          

A0A437DD16_BCL2L1-      tttgtttgtctttggtggtgt------gctgtgtgttgagtgtgt-----
A0A437D660_BCL2L1-      gctcttcgcgttcggcggggc------gctgtgcgtggagtgcgtgga--
A0A437D660_BCL2L1-      gctcttcgcgttcggcggggc------gctgtgcgtggagtgcgtgga--
A0A3S2PV78_BCL2-01      gttcttcgagttcgggggcac------cgtgtgcgtggagtgcgcgtccg
A0A3S2PV78_BCL2-02      gttcccccctgacacggacacgccactgctggccgaagaaaacaagtcca
A0A3S2PV78_BCL2-03      gttcccccctgacacggacacgccactgctggccgaagaaaacaagtcca
A0A3S2PV78_BCL2-04      --------------------------------------------------
                                                                          

A0A437DD16_BCL2L1-      -------------cgagagga-atatgagtgagctggtctcccgcatt--
A0A437D660_BCL2L1-      -------------gaaggaga----tgagccccctggtggacaggatt--
A0A437D660_BCL2L1-      -------------gaaggaga----tgagccccctggtggacaggatt--
A0A3S2PV78_BCL2-01      a------------cgaggaga----tgagcgcgcaggtggccagcatc--
A0A3S2PV78_BCL2-02      agcctttagagaccaagttgatctctgaaacctctggagtctggcagcca
A0A3S2PV78_BCL2-03      agcctttagagaccaagttgatctctgaaacctctggagtctggcagcca
A0A3S2PV78_BCL2-04      --------------------------------------------------
                                                                          

A0A437DD16_BCL2L1-      -gctgaatggatgaccatgtacctag-----------atgagcaaataag
A0A437D660_BCL2L1-      -gtggagtggatgaccgtctacctgg-----------acaaccacatc--
A0A437D660_BCL2L1-      -gtggagtggatgaccgtctacctgg-----------acaaccacatc--
A0A3S2PV78_BCL2-01      -gccgagtggatgacggaatatttaa-----------acggacctctcaa
A0A3S2PV78_BCL2-02      gaccaggtggccaaagtctttgtcaaagacgccgtgcaaggaaacttcaa
A0A3S2PV78_BCL2-03      gaccaggtggccaaagtctttgtcaaagacgccgtgcaaggaaacttcaa
A0A3S2PV78_BCL2-04      --------------------------------------------------
                                                                          

A0A437DD16_BCL2L1-      t--ccatggatccacagtcaaggaggatgg--------------------
A0A437D660_BCL2L1-      cagccgtggatccagagccaaggcggatgg--------------------
A0A437D660_BCL2L1-      cagccgtggatccagagccaaggcggatggcttctcccagaacatcagct
A0A3S2PV78_BCL2-01      cagctggata---------gaagataacgg--------------------
A0A3S2PV78_BCL2-02      cagctctgtg---------ggtcctgatggttacatgctgtcggctctca
A0A3S2PV78_BCL2-03      cagctctgtg---------ggtcctgatggttacatgctgtcggctctca
A0A3S2PV78_BCL2-04      --------------------------------------------------
                                                                          

A0A437DD16_BCL2L1-      ----------------------------------------------gatt
A0A437D660_BCL2L1-      ----------------------------------------------gaac
A0A437D660_BCL2L1-      gctgatgcgtgacatcaaacctgcggccccgcagcgtcacacgcatgaac
A0A3S2PV78_BCL2-01      -----gggatg-----------------------------------ggat
A0A3S2PV78_BCL2-02      cctgcggaatgtcacccgtcacctccatcacagaaggtctccagcaggat
A0A3S2PV78_BCL2-03      cctgcggaatgtcacccgtcacctccatcacagaaggtctccagcagatc
A0A3S2PV78_BCL2-04      -----------------------------------------------atc
                                                                          

A0A437DD16_BCL2L1-      gcttt-gcacggctgtatgga------caggatggtgctgcagaagcgag
A0A437D660_BCL2L1-      gttttgctgaaatctttgggc-------aggaggccgcagcagagagcag
A0A437D660_BCL2L1-      gttttgctgaaatctttgggc-------aggaggccgcagcagagagcag
A0A3S2PV78_BCL2-01      gcttttgtggagctgtacgacagacagaaggaaaccgtctt------cag
A0A3S2PV78_BCL2-02      gcttttgtggagctgtacgacagacagaaggaaaccgtctt------cag
A0A3S2PV78_BCL2-03      gtcaccatggggctgtttcgc------------accattgc------tct
A0A3S2PV78_BCL2-04      gtcaccatggggctgtttcgc------------accattgc------tct
                        *              *                                  

A0A437DD16_BCL2L1-      aagatttcaagagacgctgaaaaa------------gtggacgctggttg
A0A437D660_BCL2L1-      aaggtctcaggagagcttcaagaa------------gtggctgctggtgg
A0A437D660_BCL2L1-      aaggtctcaggagagcttcaagaa------------gtggctgctggtgg
A0A3S2PV78_BCL2-01      ctgctactggccgtccatcaagactgtcttcggc--ctggctgct-ctcg
A0A3S2PV78_BCL2-02      ctgctactggccgtccatcaagactgtcttcggc--ctggctgct-ctcg
A0A3S2PV78_BCL2-03      cttctacctggggagtttcgacagcatcgtgcgccgctgcatgat-tcag
A0A3S2PV78_BCL2-04      cttctacctggggagtttcgacagcatcgtgcgccgctgcatgat-tcag
                            *       *    *  * *              **   * *    *

A0A437DD16_BCL2L1-      cagtggcacttctaactggactgctgcttggtttgctcatcgccaagaa-
A0A437D660_BCL2L1-      ggatgacggtggcgaccggcgtcctggtgggatccttcatcgcccaaaaa
A0A437D660_BCL2L1-      ggatgacggtggcgaccggcgtcctggtgggatccttcatcgcccaaaaa
A0A3S2PV78_BCL2-01      gggcggcgagcctgaccatc---------ggagcataccttgcacaaaa-
A0A3S2PV78_BCL2-02      gggcggcgagcctgaccatc---------ggagcataccttgcacaaaa-
A0A3S2PV78_BCL2-03      agggagcagtcgaaaacggc---------taacaagacc--------ga-
A0A3S2PV78_BCL2-04      agggagcagtcgaaaacggc---------taacaagacc--------ga-
                              *       *                      *          * 

A0A437DD16_BCL2L1-      -----atga
A0A437D660_BCL2L1-      cgcctgtga
A0A437D660_BCL2L1-      cgcctgtga
A0A3S2PV78_BCL2-01      -----gtga
A0A3S2PV78_BCL2-02      -----gtga
A0A3S2PV78_BCL2-03      -----gtaa
A0A3S2PV78_BCL2-04      -----gtaa
                              * *

© 1998-2020Legal notice