Dataset for CDS MCL-1 of organism Gallus gallus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A1L1RNM6_MCL1-01      atgtttgcagtcaagcggaacgccgtcatcggcttcaacctctactgcgg
A0A1L1RNM6_MCL1-02      atgtttgcagtcaagcggaacgccgtcatcggcttcaacctctactgcgg

A0A1L1RNM6_MCL1-01      cggaggaagcccgggcctggtgcccgcttcaccagcaggagagcaaaccc
A0A1L1RNM6_MCL1-02      cggaggaagcccgggcctggtgcccgcttcaccagcaggagagcaaaccc

A0A1L1RNM6_MCL1-01      cgccgcccgccgccgccgctccggccgccgccgccgccaccgtcgctgag
A0A1L1RNM6_MCL1-02      cgccgcccgccgccgccgctccggccgccgccgccgccaccgtcgctgag

A0A1L1RNM6_MCL1-01      gtaccgcggccgctgattggctccgcggggctgtgggccgccgccggccg
A0A1L1RNM6_MCL1-02      gtaccgcggccgctgattggctccgcggggctgtgggccgccgccggccg

A0A1L1RNM6_MCL1-01      cgccgaagccccccgcgctcccattggctccggggcggccccccacgctc
A0A1L1RNM6_MCL1-02      cgccgaagccccccgcgctcccattggctccggggcggccccccacgctc

A0A1L1RNM6_MCL1-01      cgatcggttccgccgcggcccgccgggcgccgccggactccacgtcgcgg
A0A1L1RNM6_MCL1-02      cgatcggttccgccgcggcccgccgggcgccgccggactccacgtcgcgg

A0A1L1RNM6_MCL1-01      cccgtcgctctgtggagccccgaggaggagttggacggctgcgagcccga
A0A1L1RNM6_MCL1-02      cccgtcgctctgtggagccccgaggaggagttggacggctgcgagcccga

A0A1L1RNM6_MCL1-01      gtccgaacgcggccccggaggcgattcgttgcccggcacgccgcccgagc
A0A1L1RNM6_MCL1-02      gtccgaacgcggccccggaggcgattcgttgcccggcacgccgcccgagc

A0A1L1RNM6_MCL1-01      tgcccgacttgatccccgacgagctgcggcaggaatccctggagctcatc
A0A1L1RNM6_MCL1-02      tgcccgacttgatccccgacgagctgcggcaggaatccctggagctcatc

A0A1L1RNM6_MCL1-01      ctccggtacctccgggaggcggcgggagaggccgagcccggcgttaaaaa
A0A1L1RNM6_MCL1-02      ctccggtacctccgggaggcggcgggagaggccgagcccggcgttaaaaa

A0A1L1RNM6_MCL1-01      gctgtttccggggctcctgggagggccagggcggcccggcagggcgagca
A0A1L1RNM6_MCL1-02      gctgtttccggggctcctgggagggccagggcggcccggcagggcgagca

A0A1L1RNM6_MCL1-01      gcgccgtcatggagaaagcgctggaaacgttgcggagggtcggggacggc
A0A1L1RNM6_MCL1-02      gcgccgtcatggagaaagcgctggaaacgttgcggagggtcggggacggc

A0A1L1RNM6_MCL1-01      gtgatgcagaaacacgaattggccttccagggaatgcttcggaagctgga
A0A1L1RNM6_MCL1-02      gtgatgcagaaacacgaattggccttccagggaatgcttcggaagctgga

A0A1L1RNM6_MCL1-01      aatcaaaaaggaagatgacctgcaggctgtgtgtgaggtggctgctcacg
A0A1L1RNM6_MCL1-02      aatcaaaaaggaagatgacctgcaggctgtgtgtgaggtggctgctcacg

A0A1L1RNM6_MCL1-01      ttttcaatgatggagtaacaaactggggccgagttgtcacgctcatctca
A0A1L1RNM6_MCL1-02      ttttcaatgatggagtaacaaactggggccgagttgtcacgctcatctca

A0A1L1RNM6_MCL1-01      tttggtgcctttgttgcaaaacacctgaaaagcatcaaccaagagaaatg
A0A1L1RNM6_MCL1-02      tttggtgcctttgttgcaaaacacctgaaaagcatcaaccaagagaaatg

A0A1L1RNM6_MCL1-01      catcacctcgctggcggggatcatcacggacgcattggtctcatccaaac
A0A1L1RNM6_MCL1-02      catcacctcgctggcggggatcatcacggacgcattggtctcatccaaac

A0A1L1RNM6_MCL1-01      gcgagtggctgatgagccagggaggctgggagggctttgttgacttcttc
A0A1L1RNM6_MCL1-02      gcgagtggctgatgagccagggaggctgggagggctttgttgacttcttc

A0A1L1RNM6_MCL1-01      cgagttgaggacctggaaagcagcatcaggaatgtgctgatggcctttgc
A0A1L1RNM6_MCL1-02      cgagttgaggacctggaaagcagcatcaggaatgtgctgatggcctttgc

A0A1L1RNM6_MCL1-01      aggagtggccggcctgggggcgagcttggcctacatgatccgaaagtgga
A0A1L1RNM6_MCL1-02      aggagtggccggcctgggggcgagcttggcctacatgatccgg-------

A0A1L1RNM6_MCL1-01      ggagttga
A0A1L1RNM6_MCL1-02      -----tga

© 1998-2020Legal notice