Dataset for CDS Unclassified of organism Neogobius melanostomus

[Download (right click)]

2 sequence(s)

>gnl|bcl2dbcds|A0A8C6SIN0_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Neogobius melanostomus (length=591 residues).
atgtcgctgaacagagagctggtggttttctacatcacgtacaaactttcccagaggaacttcccctggaccacctggac
agaactgagaggcggagtcaggactgaggagggggcggggctgaggggcggagtcagaactgaagaggggtcggacactc
acactaacggctcggtgaacggcgacctggaggcggtgaaggaggctctgcaggacgcggcgaatgagttcgagctccgt
ttctcgcgcgccttcagtgacctgcaccagcagctgcacatcaccccggcgacggcgtaccgcagcttcgagagcgtcat
ggacgaggtgtttcgggacggctgtgtggagaaggagatgagcccgctggtcgcccgcatcgctgagtggatgacccttt
acctggacaaccacatccaggactggatcaccgcgcagggaggatgggctcgtttctctcagatctacggtcaggacgcg
gcggccgagtctcgtcgttcacaggagagtctgaagaagtggctctgggccgggatgactctggtgaccggggtcgtggt
cggatcactgatcgcacagaagaggctttaa
>gnl|bcl2dbcds|A0A8C6WWR3_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Neogobius melanostomus (length=633 residues).
atgtacatatgccataaactgtctaaacgtggctacgcatggggctttcacgaagacaccgaggacgaagacgacgctgc
taataacgggtcaatagttgcatcctctccggctttggtgaaccgccggtgccgcggagagcgcctctatacgcgctccg
cgcagtccgacccatacgccgccatccacagagtcttgcgcgaggctggggatgaacttgagaaactgtaccagcccgac
ttcacagagatgtccagacagctgtatctgacatcttccacggcacagaggaggtttgccgaggtcatagacgaactgtt
ccgcgacggagtgaactgggggagaattatcgcgtttttcgagtttgggggaacggtgtgcgtagagtgcgcatccaagg
aggacatgtcatcccaagtggataacatcgcagactggatgacggagtatttgaatggacctcttggcagctggattcaa
gacaacgggggatgggaggcttttgtggagctgtacgaccgtcagagggaatccgtgttcagctgctcttggccctccat
caaaaccgtgttcggactggccgccatcggagccgccagcctcaccatcggcgcgtacctgtcgcaaaaatga
© 1998-2022Legal notice