Dataset for CDS BCL-2-like of organism Monodelphis domestica

[Download (right click)] [Edit] [Sequences] [Repertoires]

10 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

F6SFL4_BCL2A1-01        atgg----------------------------------------------
F6YNL8_BCL2-01          atgatggctcaccctggaagaag---------------------------
F6WA14_BCL2L1-01        atgt----------------------------------------------
A0A5F8HG85_BCL2L2-      atgg----------------------------------------------
A0A5F8HG85_BCL2L2-      atgg----------------------------------------------
A0A5F8HG85_BCL2L2-      atgg----------------------------------------------
F6VJQ0_BCL2L10-01       atgg------attacaag-------------------------tgtgctc
A0A5F8GAQ2_MCL1-03      atgttaggccctttcaagaagaacgccgtcatcggcctcaacctttactg
A0A5F8GAQ2_MCL1-01      atgttaggccctttcaagaagaacgccgtcatcggcctcaacctttactg
A0A5F8GAQ2_MCL1-02      atgttaggccctttcaagaagaacgccgtcatcggcctcaacctttactg

F6SFL4_BCL2A1-01        -----------------------------------------------atg
F6YNL8_BCL2-01          ----------------------------aggatatgataaccgggagata
F6WA14_BCL2L1-01        ------------------------------cgcacagtaaccgggagctg
A0A5F8HG85_BCL2L2-      ---------------cggcggcggcggcggcggcagcagc---agcgggg
A0A5F8HG85_BCL2L2-      ---------------cgactccagcctcagccccagatactcgagccctg
A0A5F8HG85_BCL2L2-      ---------------cgactccagcctcagccccagatactcgagccctg
F6VJQ0_BCL2L10-01       t-------taggga--------agagacggcg----------------cg
A0A5F8GAQ2_MCL1-03      tggcggggcagggatgggcgccggcggcggcgccagcggtcccccgtccg
A0A5F8GAQ2_MCL1-01      tggcggggcagggatgggcgccggcggcggcgccagcggtcccccgtccg
A0A5F8GAQ2_MCL1-02      tggcggggcagggatgggcgccggcggcggcgccagcggtcccccgtccg

F6SFL4_BCL2A1-01        attacgagttccattatgttcacatgttagctcgg---------------
F6YNL8_BCL2-01          gtgatgaaatacattcattataaactgtcacagagggggtacgagtg---
F6WA14_BCL2L1-01        gtgattgactttctttcttacaagctctcacagaaaggatacaattg---
A0A5F8HG85_BCL2L2-      gctgcgggcggtcgaggctccgggccggggcggcggcgccat-cttgt-g
A0A5F8HG85_BCL2L2-      gtggcagattttgtgggttacaagctgaggcagaagggctatgcctgtgg
A0A5F8HG85_BCL2L2-      gtggcagattttgtgggttacaagctgaggcagaagggctatgcctgtgg
F6VJQ0_BCL2L10-01       gctggtaactgacta-cct----------------------ggaatatt-
A0A5F8GAQ2_MCL1-03      gcgggcgcctg-cta-gcttctggcaaaggccctacggttgagagtactc
A0A5F8GAQ2_MCL1-01      gcgggcgcctg-cta-gcttctggcaaaggccctacggttgagagtactc
A0A5F8GAQ2_MCL1-02      gcgggcgcctg-cta-gcttctggcaaaggccctacggttgagagtactc

F6SFL4_BCL2A1-01        --------------------------------------------------
F6YNL8_BCL2-01          --------------------------------------------------
F6WA14_BCL2L1-01        ----gagtcagtttgaagatgagaacaggactgaggttctagaaggggca
A0A5F8HG85_BCL2L2-      cccggggccg----ggggggagcccggggagggggcc------ccgggcg
A0A5F8HG85_BCL2L2-      aactggccca----ggagagggccctacaacagagcccttgcaccgggcc
A0A5F8HG85_BCL2L2-      aactggccca----ggagagggccctacaacagagcccttgcaccgggcc
F6VJQ0_BCL2L10-01       --------------------------------------------------
A0A5F8GAQ2_MCL1-03      cgccgcagcgcgatggaggggaagtggaaacagggac---ggcgggggca
A0A5F8GAQ2_MCL1-01      cgccgcagcgcgatggaggggaagtggaaacagggac---ggcgggggca
A0A5F8GAQ2_MCL1-02      cgccgcagcgcgatggaggggaagtggaaacagggac---ggcgggggca

F6SFL4_BCL2A1-01        -----gactacttgaagcatgttcaacagacaccaccactgggatcatgt
F6YNL8_BCL2-01          -----ggatgct--ggagatctgagggcaccagcctctccaagtcttcct
F6WA14_BCL2L1-01        gagatacctagtactgtga-------atggcagtccctcttggcaccctg
A0A5F8HG85_BCL2L2-      gcgcgggggactacgggaacgggctggag--------gcggag-------
A0A5F8HG85_BCL2L2-      atgcgtgctgct--ggagacgagtttgagtcccgctttcgacgcacattt
A0A5F8HG85_BCL2L2-      atgcgtgctgct--ggagacgagtttgagtcccgctttcgacgcacattt
F6VJQ0_BCL2L10-01       ------gttgccggaggga-------------------------------
A0A5F8GAQ2_MCL1-03      gggttgattggcggaggaatccgtgcgag-------tcctccgaatcctg
A0A5F8GAQ2_MCL1-01      gggttgattggcggaggaatccgtgcgag-------tcctccgaatcctg
A0A5F8GAQ2_MCL1-02      gggttgattggcggaggaatccgtgcgag-------tcctccgaatcctg

F6SFL4_BCL2A1-01        ctaaataagacatctcaaatac----------------------------
F6YNL8_BCL2-01          cctgttgttgcttctg--------------cccctgctgttggaatcttc
F6WA14_BCL2L1-01        ------ctgacagccgtgctgtgagtggggccacag-----gg-------
A0A5F8HG85_BCL2L2-      ---gagctggagcctgag---------gaattgctgc--taga-------
A0A5F8HG85_BCL2L2-      tctgatctggccgctcagttgc-atgtgactcctggc--tcgg-------
A0A5F8HG85_BCL2L2-      tctgatctggccgctcagttgc-atgtgactcctggc--tcgg-------
F6VJQ0_BCL2L10-01       -------aggcgtccaggagct-gc-cggcccctaccc-ctgc-------
A0A5F8GAQ2_MCL1-03      tctcgccgggcgcccggggggtcgcgcggcccgcacccattgg-------
A0A5F8GAQ2_MCL1-01      tctcgccgggcgcccggggggtcgcgcggcccgcacccattgg-------
A0A5F8GAQ2_MCL1-02      tctcgccgggcgcccggggggtcgcgcggcccgcacccattgg-------

F6SFL4_BCL2A1-01        ----tacaaaagg-------------------------ttgctttctctg
F6YNL8_BCL2-01          tctacccagccac----------gaaacacaccattgcctgctgctgctg
F6WA14_BCL2L1-01        ----cacagcagcagcctggatgcccatgagacaataccagtggctgctg
A0A5F8HG85_BCL2L2-      ----gccaga------------------gc-------ccgag--cccgag
A0A5F8HG85_BCL2L2-      ----ctcagcagc----------gctttac-------ccagg--tctcag
A0A5F8HG85_BCL2L2-      ----ctcagcagc----------gctttac-------ccagg--tctcag
F6VJQ0_BCL2L10-01       ----tgcag--------------------ctacactgc--gt--ttggtg
A0A5F8GAQ2_MCL1-03      ----cgcggaggc----------ccccgacgtcaccaccgat--ccgatg
A0A5F8GAQ2_MCL1-01      ----cgcggaggc----------ccccgacgtcaccaccgat--ccgatg
A0A5F8GAQ2_MCL1-02      ----cgcggaggc----------ccccgacgtcaccaccgat--ccgatg
                              *                                          *

F6SFL4_BCL2A1-01        tccaacaagaagtagaaaa------------------------ggatatg
F6YNL8_BCL2-01          ctgc-----------tggacctaccgtcagtccagtgccacctgtggtcc
F6WA14_BCL2L1-01        tgaagcaagctttgagggaggc--------------------aggagatg
A0A5F8HG85_BCL2L2-      --------cccgaggaggagccgccccggccccgtgcccccccgg-----
A0A5F8HG85_BCL2L2-      atgagctcttccaaggggggcccaactggggccgt---cttgtgg-----
A0A5F8HG85_BCL2L2-      atgagctcttccaaggggggcccaactggggccgt---cttgtgg-----
F6VJQ0_BCL2L10-01       tcgagcgagct--------------------------ccgccagatttac
A0A5F8GAQ2_MCL1-03      ccgagcctgttcgcgccgggccgctgctcgtcggcgcccgccgaggtggc
A0A5F8GAQ2_MCL1-01      ccgagcctgttcgcgccgggccgctgctcgtcggcgcccgccgaggtggc
A0A5F8GAQ2_MCL1-02      ccgagcctgttcgcgccgggccgctgctcgtcggcgcccgccgaggtggc

F6SFL4_BCL2A1-01        gaaacatgcttgagcactttggacatcgtttctgtagagtct-gccagaa
F6YNL8_BCL2-01          acctgactcttcgtcaagctggagatgatttctctagaaggtaccgga--
F6WA14_BCL2L1-01        aatttgaacttcgg---tacaggcgggcatt---cagtgacctgacatcc
A0A5F8HG85_BCL2L2-      ----gagcctccggccctgg------gcccggcgcaggagcc-cccggca
A0A5F8HG85_BCL2L2-      ----cattcttcgtctttggggcagcgctctgtgcagagagt-gtcaaca
A0A5F8HG85_BCL2L2-      ----cattcttcgtctttggggcagcgctctgtgcagagagt-gtcaaca
F6VJQ0_BCL2L10-01       c---aggacttc-----ttcgagtgcgccctga--atcagctactcgacc
A0A5F8GAQ2_MCL1-03      cgatggggctgcggacgtcccaatgtgccctgaggaggaactggacggtt
A0A5F8GAQ2_MCL1-01      cgatggggctgcggacgtcccaatgtgccctgaggaggaactggacggtt
A0A5F8GAQ2_MCL1-02      cgatggggctgcggacgtcccaatgtgccctgaggaggaactggacggtt
                                **                         *              

F6SFL4_BCL2A1-01        gaattttcaatagtgttatgaagaa-------------------------
F6YNL8_BCL2-01          --------gagactttgatgaaatgtcaggtcaactgcacctgacccctg
F6WA14_BCL2L1-01        cagctccacatcacgccaggaa----------------------------
A0A5F8HG85_BCL2L2-      gtcaggaggag--------gaggaagagccgggcctggtcgagggcg---
A0A5F8HG85_BCL2L2-      aagagatggagccactggtgggacaggtgcaggactggatggtgacc---
A0A5F8HG85_BCL2L2-      aagagatggagccactggtgggacaggtgcaggactggatggtgacc---
F6VJQ0_BCL2L10-01       gggaacctgagc--------aagta------------------atcg---
A0A5F8GAQ2_MCL1-03      acgagcccgagcctcccgggaagcg------------------gccc---
A0A5F8GAQ2_MCL1-01      acgagcccgagcctcccgggaagcg------------------gccc---
A0A5F8GAQ2_MCL1-02      acgagcccgagcctcccgggaagcg------------------gccc---

F6SFL4_BCL2A1-01        ------------ggaatttgaggatgg----------------------c
F6YNL8_BCL2-01          ttactgctaggggacgctttgccacagtggtagaggagctgttcagggat
F6WA14_BCL2L1-01        ---cagcttatcagagctttgagcaggtagtgaatgaactcttccgggat
A0A5F8HG85_BCL2L2-      -acccgggggacggcgct---atc--------------------------
A0A5F8HG85_BCL2L2-      -tacctagagacacagct---ggcaga----------------ctggatc
A0A5F8HG85_BCL2L2-      -tacctagagacacagct---ggcaga----------------ctggatc
F6VJQ0_BCL2L10-01       -t-caacgtagcggagct---catgga----------------ccgaggc
A0A5F8GAQ2_MCL1-03      -tcccgcctggctgtgctggaaatagc----------------ccgggaa
A0A5F8GAQ2_MCL1-01      -tcccgcctggctgtgctggaaatagc----------------ccgggaa
A0A5F8GAQ2_MCL1-02      -tcccgcctggctgtgctggaaatagc----------------ccgggaa

F6SFL4_BCL2A1-01        gtcattaactggggacggattgtcaccatatttgcttttgggggaattct
F6YNL8_BCL2-01          ggggtgaactgggggaggatcgtggccttctttgagtttggtggtgt-ta
F6WA14_BCL2L1-01        ggggtgaactggggccgaattgtggcattcttctccttcggaggggc-at
A0A5F8HG85_BCL2L2-      ---------gaggacccg------gagctggaggccatcaaag-----cc
A0A5F8HG85_BCL2L2-      cacagcagtgggggctgg------gagctggaggccatcaaag-----cc
A0A5F8HG85_BCL2L2-      cacagcagtgggggctgg------gagctggaggccatcaaag-----cc
F6VJQ0_BCL2L10-01       gagttcaactggggccgggtggcggtgctagtggtttttgccggggc---
A0A5F8GAQ2_MCL1-03      gg-------tggggacagcccgaacggctctttgccttcgacgccgcccc
A0A5F8GAQ2_MCL1-01      gg-------tggggacagcccgaacggctctttgccttcgacgccgcccc
A0A5F8GAQ2_MCL1-02      gg-------tggggacagcccgaacggctctttgccttcgacgccgcccc
                                   **               *        *    *       

F6SFL4_BCL2A1-01        ca--tcaagaagcttctgagacatagagctccactgactatgggcactca
F6YNL8_BCL2-01          tgtgtgtggagagcgtcaaccgggag------atgtc--------gcccc
F6WA14_BCL2L1-01        tgtgtgtggaaagcgtggataaggag------atgga--------agtct
A0A5F8HG85_BCL2L2-      cgagtaagggag--atggaggaagag------gcaga--------gaaat
A0A5F8HG85_BCL2L2-      cgagtaagggag--atggaggaagag------gcaga--------gaaat
A0A5F8HG85_BCL2L2-      cgagtaagggag--atggaggaagag------gcaga--------gaaat
F6VJQ0_BCL2L10-01       --gctgctggag--atggaggaacta------ctgaa--agaggagcagg
A0A5F8GAQ2_MCL1-03      cagctgaggagg--atgaagaagagg------atgaactatacgggcagt
A0A5F8GAQ2_MCL1-01      cagctgaggagg--atgaagaagagg------atgaactatacgggcagt
A0A5F8GAQ2_MCL1-02      cagctgaggagg--atgaagaagagg------atgaactatacgggcagt
                            *   *         *                               

F6SFL4_BCL2A1-01        ggaagaaatttctcattttattgccgagttcata-----atgaacaatat
F6YNL8_BCL2-01          tggtggacagcattgccctatggatgactgagtacctgaaccggcacctg
F6WA14_BCL2L1-01        tggtaggacgcatcacctcctggatggccacttacttggatgaccaccta
A0A5F8HG85_BCL2L2-      tgaaggagct--tcagaacgaggtgga-----gaaacagatgaaca----
A0A5F8HG85_BCL2L2-      tgaaggagct--tcagaacgaggtgga-----gaaacagatgaaca----
A0A5F8HG85_BCL2L2-      tgaaggagct--tcagaacgaggtgga-----gaaacagatgaaca----
F6VJQ0_BCL2L10-01       tactgcagct--tcgga-------ggg-----aa-----acgagcc----
A0A5F8GAQ2_MCL1-03      ccttggagctcatcagc-------cgg-----taccttcgcgagca----
A0A5F8GAQ2_MCL1-01      ccttggagctcatcagc-------cgg-----taccttcgcgagca----
A0A5F8GAQ2_MCL1-02      ccttggagctcatcagc-------cgg-----taccttcgcgagca----
                                    *            *       *          *     

F6SFL4_BCL2A1-01        agcagagtggataagacaaaatggaggatgggaaa---------------
F6YNL8_BCL2-01          cacac-ttggatccaggataacggaggatgggtag---------------
F6WA14_BCL2L1-01        gaccc-ttggatccaagaaaatggcggctgggacacct------ttgtgg
A0A5F8HG85_BCL2L2-      -tgag-tccacccccaggcaatgctggcccagtgatcatgtccattgagg
A0A5F8HG85_BCL2L2-      -tgag-tccacccccaggcaatgctggcccagtgatcatgtccattgagg
A0A5F8HG85_BCL2L2-      -tgag-tccacccccaggcaatgctggcccagtgatcatgtccattgagg
F6VJQ0_BCL2L10-01       -ggcg-tctgac-cgaa--a-----aactctgcaactatc----tggtgg
A0A5F8GAQ2_MCL1-03      -ggcg-gttggcacgaagga-----ggccaagcccctacg----cagcgg
A0A5F8GAQ2_MCL1-01      -ggcg-gttggcacgaagga-----ggccaagcccctacg----cagcgg
A0A5F8GAQ2_MCL1-02      -ggcg-gttggcacgaagga-----ggccaagcccctacg----cagcgg
                                           *           *                  

F6SFL4_BCL2A1-01        --------------------------------------------------
F6YNL8_BCL2-01          --------------------------------------------------
F6WA14_BCL2L1-01        aa------------------------ctttatgggaatgatgcag----c
A0A5F8HG85_BCL2L2-      agaagatggaggctgatgcccgatccatctatgtaggcaatgtggactat
A0A5F8HG85_BCL2L2-      agaagatggaggctgatgcccgatccatctatgtaggcaatgtggactat
A0A5F8HG85_BCL2L2-      agaagatggaggctgatgcccgatccatctatgtaggcaatgtggactat
F6VJQ0_BCL2L10-01       agagg----aag---------ggcgcgtggctgcatgaga-acggaggct
A0A5F8GAQ2_MCL1-03      caaggccttaga---------gaccctgcgacgcgtgggagacggtgtcc
A0A5F8GAQ2_MCL1-01      caaggccttaga---------gaccctgcgacgcgtgggagacggtgtcc
A0A5F8GAQ2_MCL1-02      caaggccttaga---------gaccctgcgacgcgtgggagacggtgtcc

F6SFL4_BCL2A1-01        --------------atggctttgtaaagaa--ctttgaacctaatacagt
F6YNL8_BCL2-01          --------------------------------------------------
F6WA14_BCL2L1-01        tgcagagagccggaagggcc-----aggaacgcttcaaccgatggctg--
A0A5F8HG85_BCL2L2-      ggtgcaacagcagaagagct---ggaggcacacttccatggttgt--ggt
A0A5F8HG85_BCL2L2-      ggtgcaacagcagaagagct---ggaggcacacttccatggttgt--ggt
A0A5F8HG85_BCL2L2-      ggtgcaacagcagaagagct---ggaggcacacttccatggttgt--ggt
F6VJQ0_BCL2L10-01       gga-----------ctggctttcaccacca--cttcgaaaaaaggcaatc
A0A5F8GAQ2_MCL1-03      agaggaaccacgagagggctttccaaggcatgcttcggaaattgg--ata
A0A5F8GAQ2_MCL1-01      agaggaaccacgagagggctttccaaggcatgcttcggaaattgg--ata
A0A5F8GAQ2_MCL1-02      agaggaaccacgagagggctttccaaggcatgcttcggaaattgg--ata

F6SFL4_BCL2A1-01        --------------------------gtggccgaactt------------
F6YNL8_BCL2-01          --------------------------gtgcctag----------------
F6WA14_BCL2L1-01        --------------------------ctgactggcatgac----------
A0A5F8HG85_BCL2L2-      tca-----------------------gttaatcgagttaccatcctttgt
A0A5F8HG85_BCL2L2-      tca-----------------------gttaatcgagttaccatcctttgt
A0A5F8HG85_BCL2L2-      tca-----------------------gttaatcgagttaccatcctttgt
F6VJQ0_BCL2L10-01       tcctccaccaa---------------gtgactcaagtaataatacactgt
A0A5F8GAQ2_MCL1-03      tcaaaaacgaagaggatattaaagctgtgtctcgagtggcgaccca-tgt
A0A5F8GAQ2_MCL1-01      tcaaaaacgaagaggatattaaagctgtgtctcgagtggcgaccca-tgt
A0A5F8GAQ2_MCL1-02      tcaaaaacgaagaggatattaaagctgtgtctcgagtggcgaccca-tgt

F6SFL4_BCL2A1-01        -----------------------------------cacagatattt----
F6YNL8_BCL2-01          --------------------------------------------------
F6WA14_BCL2L1-01        ---------agtggcc-------------------ggtgtagtcct----
A0A5F8HG85_BCL2L2-      gacaagttcagtggccatcctaaggggtttgcatatatagaattttcaga
A0A5F8HG85_BCL2L2-      gacaagttcagtggccatcctaaggggtttgcatatatagaattttcaga
A0A5F8HG85_BCL2L2-      gacaagttcagtggccatcctaaggggtttgcatatatagaattttcaga
F6VJQ0_BCL2L10-01       gctgcat--aatggc------agcagc--------agcaggatttg----
A0A5F8GAQ2_MCL1-03      tttcagt--gacggtataacaaactgg--------ggcaggattgt----
A0A5F8GAQ2_MCL1-01      tttcagt--gacggtataacaaactgg--------ggcaggattgt----
A0A5F8GAQ2_MCL1-02      tttcagt--gacggtataacaaactgg--------ggcaggattgt----

F6SFL4_BCL2A1-01        --------------------------------------------------
F6YNL8_BCL2-01          --------------------------------------------------
F6WA14_BCL2L1-01        --------------------------------------------------
A0A5F8HG85_BCL2L2-      taaagattcagtcaggacgtcgatggccttggatgattctcttttcagag
A0A5F8HG85_BCL2L2-      taaagattcagtcaggacgtcgatggccttggatgattctcttttcagag
A0A5F8HG85_BCL2L2-      taaagattcagtcaggacgtcgatggccttggatgattctcttttcagag
F6VJQ0_BCL2L10-01       ---------------gact-------------------------------
A0A5F8GAQ2_MCL1-03      ---------------gactctcatttctttcggtg----cctttgtggca
A0A5F8GAQ2_MCL1-01      ---------------gactctcatttctttcggtg----cctttgtggca
A0A5F8GAQ2_MCL1-02      ---------------gactctcatttctttcggtg----cctttgtggca

F6SFL4_BCL2A1-01        --------------------------------------------------
F6YNL8_BCL2-01          --------------------------------------------------
F6WA14_BCL2L1-01        --------------------------------------------------
A0A5F8HG85_BCL2L2-      gaagacagatcaaagtgataccaaaacggaccaataggccggggatcag-
A0A5F8HG85_BCL2L2-      gaagacagatcaaagtgataccaaaacggaccaataggccggggatcag-
A0A5F8HG85_BCL2L2-      gaagacagatcaaagtgataccaaaacggaccaataggccggggatcag-
F6VJQ0_BCL2L10-01       --------------------------------------------------
A0A5F8GAQ2_MCL1-03      aagcacttgaagagcataaaccaggaaagttgcatagacccgctagcaga
A0A5F8GAQ2_MCL1-01      aagcacttgaagagcataaaccaggaaagttgcatagacccgctagcaga
A0A5F8GAQ2_MCL1-02      aagcacttgaagagcataaaccaggaaagttgcatagacccgctagcaga

F6SFL4_BCL2A1-01        ---------------------caacaaagatctggggcatatttt-----
F6YNL8_BCL2-01          --------------------------------------------------
F6WA14_BCL2L1-01        -----------------------------gctggggt-------------
A0A5F8HG85_BCL2L2-      ---------------------caccacagatcggggttttccacgtgccc
A0A5F8HG85_BCL2L2-      ---------------------caccacagatcggggttttccacgtgccc
A0A5F8HG85_BCL2L2-      ---------------------caccacagatcggggttttccacgtgccc
F6VJQ0_BCL2L10-01       -----------------------------agtgggat--------tagct
A0A5F8GAQ2_MCL1-03      aagcataacagatgttctggtcaagacaaaacgggac--------tggct
A0A5F8GAQ2_MCL1-01      aagcataacagatgttctggtcaagacaaaacgggac--------tggct
A0A5F8GAQ2_MCL1-02      aagcataacagatgttctggtcaagacaaaacgggac--------tggct

F6SFL4_BCL2A1-01        --------------------------------------------------
F6YNL8_BCL2-01          --------------------------------------------------
F6WA14_BCL2L1-01        --------------------------------------------------
A0A5F8HG85_BCL2L2-      gatatcgtgccagggctactaactacagtagttcacgctctcgattctat
A0A5F8HG85_BCL2L2-      gatatcgtgccagggctactaactacagtagttcacgctctcgattctat
A0A5F8HG85_BCL2L2-      gatatcgtgccagggctactaactacagtagttcacgctctcgattctat
F6VJQ0_BCL2L10-01       --------------------------------------------------
A0A5F8GAQ2_MCL1-03      gattaagcaaaagggctggga-----gggatttgtggaattctttcatgt
A0A5F8GAQ2_MCL1-01      gattaagcaaaagggctggaa-----agg------------cctccttgc
A0A5F8GAQ2_MCL1-02      gattaagcaaaagggctggtc-----ag----------------------

F6SFL4_BCL2A1-01        --------------------------------------------------
F6YNL8_BCL2-01          --------------------------------------------------
F6WA14_BCL2L1-01        --------------------------------------------------
A0A5F8HG85_BCL2L2-      agcggcttcaacagcagaccccggggccgag-------------------
A0A5F8HG85_BCL2L2-      agcggcttcaacagcagaccccggggccgag-------------------
A0A5F8HG85_BCL2L2-      agcggcttcaacagcagaccccggggccgag-------------------
F6VJQ0_BCL2L10-01       --------------------------------------------------
A0A5F8GAQ2_MCL1-03      acaggacctagaaggtggcatcagaaatg---------------------
A0A5F8GAQ2_MCL1-01      tcaagacacggaagaagccacccgaaccggcgatccctgcgccccctcct
A0A5F8GAQ2_MCL1-02      ---------ggaaggagagagtggatcca---------------------

F6SFL4_BCL2A1-01        ----------------------------cctttctga-------------
F6YNL8_BCL2-01          --------------------------------------------------
F6WA14_BCL2L1-01        ----------------------------ccctattcagccgga-------
A0A5F8HG85_BCL2L2-      ----------------------------tctacaggggccgggctagagc
A0A5F8HG85_BCL2L2-      ----------------------------tctacaggggccgggctagagc
A0A5F8HG85_BCL2L2-      ----------------------------tctacaggggccgggctagagc
F6VJQ0_BCL2L10-01       ----------------------------cttttattagtcgtac------
A0A5F8GAQ2_MCL1-03      -------------------tgctgctcgcctttgccggtgttgctggagt
A0A5F8GAQ2_MCL1-01      cggcatacctcctcctctgcgcagaacccttgttctggtggtgccagctc
A0A5F8GAQ2_MCL1-02      ----------------------agaggccttgt-----------------

F6SFL4_BCL2A1-01        --------------------------------------------------
F6YNL8_BCL2-01          --------------------------------------------------
F6WA14_BCL2L1-01        --------------------------------------------------
A0A5F8HG85_BCL2L2-      gacgtcatggtattcccctt------------------------------
A0A5F8HG85_BCL2L2-      gacgtcatggt------ttc------------------------------
A0A5F8HG85_BCL2L2-      gacgtcatggtattcccctt------------------------------
F6VJQ0_BCL2L10-01       --------------------------------------------------
A0A5F8GAQ2_MCL1-03      a-ggagctggtttggcatat--------------------------ctaa
A0A5F8GAQ2_MCL1-01      acagcatcgggctgtcatgttccggataagcccaggaatgtgcttactga
A0A5F8GAQ2_MCL1-02      ----------------------------------------------ctca

F6SFL4_BCL2A1-01        ---agtaa------------------------------------------
F6YNL8_BCL2-01          --------------------------------------------------
F6WA14_BCL2L1-01        ---agtga------------------------------------------
A0A5F8HG85_BCL2L2-      ---actaa------------------------------------------
A0A5F8HG85_BCL2L2-      ---tgtag------------------------------------------
A0A5F8HG85_BCL2L2-      ---actaa------------------------------------------
F6VJQ0_BCL2L10-01       ---gataa------------------------------------------
A0A5F8GAQ2_MCL1-03      taagatag------------------------------------------
A0A5F8GAQ2_MCL1-01      ggagagaaaatgggctgcctcgctgcaacgttctcacaacaaattctcca
A0A5F8GAQ2_MCL1-02      ggaggaaa------------------------------------------

F6SFL4_BCL2A1-01        --------------------------
F6YNL8_BCL2-01          --------------------------
F6WA14_BCL2L1-01        --------------------------
A0A5F8HG85_BCL2L2-      --------------------------
A0A5F8HG85_BCL2L2-      --------------------------
A0A5F8HG85_BCL2L2-      --------------------------
F6VJQ0_BCL2L10-01       --------------------------
A0A5F8GAQ2_MCL1-03      --------------------------
A0A5F8GAQ2_MCL1-01      cttcaatgataactcatggactctag
A0A5F8GAQ2_MCL1-02      ----------------------ctga

© 1998-2021Legal notice