Dataset for CDS BCL-2-like of organism Monodelphis domestica

[Download (right click)] [Edit] [Sequences] [Repertoires]

7 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


F6SFL4_BCL2A1-01       atg-----------------------------------------------
F6YNL8_BCL2-01         atgatgg------------------------------------ctcaccc
F6WA14_BCL2L1-01       atgt---------------------------------------cgcacag
F6VJQ0_BCL2L10-01      atgg------attacaag-------------------------tgtgctc
F6ZMX1_MCL1-03         atgttaggccctttcaagaagaacgccgtcatcggcctcaacctttactg
F6ZMX1_MCL1-01         atgttaggccctttcaagaagaacgccgtcatcggcctcaacctttactg
F6ZMX1_MCL1-02         atgttaggccctttcaagaagaacgccgtcatcggcctcaacctttactg
                       ***                                               

F6SFL4_BCL2A1-01       --------------------------------------------------
F6YNL8_BCL2-01         tggaagaagaggatatgataaccggga-----------------------
F6WA14_BCL2L1-01       t-----aaccggga------------------------------------
F6VJQ0_BCL2L10-01      t-------taggga--------agagacggcg----------------cg
F6ZMX1_MCL1-03         tggcggggcagggatgggcgccggcggcggcgccagcggtcccccgtccg
F6ZMX1_MCL1-01         tggcggggcagggatgggcgccggcggcggcgccagcggtcccccgtccg
F6ZMX1_MCL1-02         tggcggggcagggatgggcgccggcggcggcgccagcggtcccccgtccg
                                                                         

F6SFL4_BCL2A1-01       gatgattacgagttccattatgttca------------------------
F6YNL8_BCL2-01         gatagtgatgaaatacattcattataaactgtcacagagggggtacg---
F6WA14_BCL2L1-01       gctggtgattgactttctttcttacaagctctcacagaaaggatacaatt
F6VJQ0_BCL2L10-01      gctggtaactgactacct----------------------gga-atatt-
F6ZMX1_MCL1-03         gcgggcgcctg-ctagcttctggcaaaggccctacggttgaga-gtactc
F6ZMX1_MCL1-01         gcgggcgcctg-ctagcttctggcaaaggccctacggttgaga-gtactc
F6ZMX1_MCL1-02         gcgggcgcctg-ctagcttctggcaaaggccctacggttgaga-gtactc
                       *            *   *                                

F6SFL4_BCL2A1-01       -----------------------------------catgttagctcggga
F6YNL8_BCL2-01         ------agtgggatgctggagatctgagggca---ccagcctctccaagt
F6WA14_BCL2L1-01       ggagtcagtttgaagatgagaacaggactgaggttctagaaggggcagag
F6VJQ0_BCL2L10-01      --------------------------------------------------
F6ZMX1_MCL1-03         cgccgcagcgcgatggaggggaagtggaaacagggacggcgggggcaggg
F6ZMX1_MCL1-01         cgccgcagcgcgatggaggggaagtggaaacagggacggcgggggcaggg
F6ZMX1_MCL1-02         cgccgcagcgcgatggaggggaagtggaaacagggacggcgggggcaggg
                                                                         

F6SFL4_BCL2A1-01       ctacttgaagca--------------------------------------
F6YNL8_BCL2-01         cttcctcctgttgttgcttctgcccctgctgttggaatcttctc------
F6WA14_BCL2L1-01       atacctagtactgtga--atggcagtccctcttggcaccctgctgacagc
F6VJQ0_BCL2L10-01      ---gttgccggaggga-------------------------------agg
F6ZMX1_MCL1-03         ttgattggcggaggaatccgtgcgagtcctccgaatcctgtctcgccggg
F6ZMX1_MCL1-01         ttgattggcggaggaatccgtgcgagtcctccgaatcctgtctcgccggg
F6ZMX1_MCL1-02         ttgattggcggaggaatccgtgcgagtcctccgaatcctgtctcgccggg
                            *                                            

F6SFL4_BCL2A1-01       tgttc------------aacagacaccacca----ctgggatcatgtcta
F6YNL8_BCL2-01         tacccagc---------cacgaaacacaccattgcctgctgctgctgctg
F6WA14_BCL2L1-01       cgtgctgtgagtggggccacagggcacagcag---cagcc-tggatgccc
F6VJQ0_BCL2L10-01      cgtccaggagct-g---c-cggcccctaccc----ctgctgcag------
F6ZMX1_MCL1-03         cgcccggggggtcg---cgcggcccgcaccca---ttggcgcggaggccc
F6ZMX1_MCL1-01         cgcccggggggtcg---cgcggcccgcaccca---ttggcgcggaggccc
F6ZMX1_MCL1-02         cgcccggggggtcg---cgcggcccgcaccca---ttggcgcggaggccc
                           *              *       * *       *            

F6SFL4_BCL2A1-01       aataagacatctcaaat----actacaaaaggttgctttctctgt-----
F6YNL8_BCL2-01         ctggacctaccgtcagt--ccagtgccacctg-tggtccacctgactct-
F6WA14_BCL2L1-01       atga-gacaataccagtggctgctgtgaagca-agct-------------
F6VJQ0_BCL2L10-01      ----ctacactgc--gt--ttggtgtcgagcg-agct-------------
F6ZMX1_MCL1-03         ccgacgtcaccaccgat--ccgatgccgagcc-tgttcgcgccgggccgc
F6ZMX1_MCL1-01         ccgacgtcaccaccgat--ccgatgccgagcc-tgttcgcgccgggccgc
F6ZMX1_MCL1-02         ccgacgtcaccaccgat--ccgatgccgagcc-tgttcgcgccgggccgc
                               *       *      *          * *             

F6SFL4_BCL2A1-01       -------------ccaacaagaagtagaaaaggatatg---gaaacatgc
F6YNL8_BCL2-01         -------------tcgtcaagctggag---atgatttctctagaaggtac
F6WA14_BCL2L1-01       ---ttgagggaggcag--gagatgaat--ttgaacttc----gg---tac
F6VJQ0_BCL2L10-01      -------------ccgccagatttacc---aggacttc---------ttc
F6ZMX1_MCL1-03         tgctcgtcggcgcccgccgaggtggccgatggggctgc----ggacgtcc
F6ZMX1_MCL1-01         tgctcgtcggcgcccgccgaggtggccgatggggctgc----ggacgtcc
F6ZMX1_MCL1-02         tgctcgtcggcgcccgccgaggtggccgatggggctgc----ggacgtcc
                                                                      * *

F6SFL4_BCL2A1-01       ttgagcactttgg--------------------------acatcgtttct
F6YNL8_BCL2-01         cggagagactttg--atgaaatgtcaggtcaactgcacctgacc---cct
F6WA14_BCL2L1-01       aggcgggcattc---agtgacctgacatccca--gctccacatcacgcca
F6VJQ0_BCL2L10-01      gagtgcgccctga--atcagctactcgaccgg--gaacctgagc------
F6ZMX1_MCL1-03         caatgtgccctgaggaggaactggacggttac--gagcccgagcctcccg
F6ZMX1_MCL1-01         caatgtgccctgaggaggaactggacggttac--gagcccgagcctcccg
F6ZMX1_MCL1-02         caatgtgccctgaggaggaactggacggttac--gagcccgagcctcccg
                           *     *                              * *      

F6SFL4_BCL2A1-01       gtagagt------ctgccagaagaattttcaatagtgttatgaagaagga
F6YNL8_BCL2-01         gtta---------ctgctaggggacgctttgccacagtggtagaggagct
F6WA14_BCL2L1-01       ggaa---------cagcttatcagagctttgagcaggtagtgaatgaact
F6VJQ0_BCL2L10-01      --aagtaatcgt-caacgtagcggagct---catgg--------------
F6ZMX1_MCL1-03         ggaagcggccctcccgcctggctgtgctggaaatag--------------
F6ZMX1_MCL1-01         ggaagcggccctcccgcctggctgtgctggaaatag--------------
F6ZMX1_MCL1-02         ggaagcggccctcccgcctggctgtgctggaaatag--------------
                                    *  *          *                      

F6SFL4_BCL2A1-01       atttgaggatggcgtcattaactggggacggattgtcaccatatttgctt
F6YNL8_BCL2-01         gttcagggatggggtg---aactgggggaggatcgtggccttctttgagt
F6WA14_BCL2L1-01       cttccgggatggggtg---aactggggccgaattgtggcattcttctcct
F6VJQ0_BCL2L10-01      --accgaggcgagttc---aactggggccgggtggcggtgctagtggttt
F6ZMX1_MCL1-03         --cccgggaagg----------tggggacagcccgaacggctctttgcct
F6ZMX1_MCL1-01         --cccgggaagg----------tggggacagcccgaacggctctttgcct
F6ZMX1_MCL1-02         --cccgggaagg----------tggggacagcccgaacggctctttgcct
                              *  *           *****       *      *  *    *

F6SFL4_BCL2A1-01       ttgggggaattct------------catcaagaagcttctgagacataga
F6YNL8_BCL2-01         ttggtggtgttatgtgtgtggagagcgtcaaccgggagatgtc-------
F6WA14_BCL2L1-01       tcggaggggcattgtgtgtggaaagcgtggataaggagatgga-------
F6VJQ0_BCL2L10-01      ttgccggggc-----gc-tgctggagatggaggaactactgaa--agagg
F6ZMX1_MCL1-03         tcgacgccgcccccagc-tgaggaggatgaagaagaggatgaactatacg
F6ZMX1_MCL1-01         tcgacgccgcccccagc-tgaggaggatgaagaagaggatgaactatacg
F6ZMX1_MCL1-02         tcgacgccgcccccagc-tgaggaggatgaagaagaggatgaactatacg
                       * *  *                     *  *        **         

F6SFL4_BCL2A1-01       gctccactgactatgggcactcaggaagaaatttctcattttattgccga
F6YNL8_BCL2-01         --------gcccctgg------tggacagcattgccctatggatgactga
F6WA14_BCL2L1-01       --------agtcttgg------taggacgcatcacctcctggatggccac
F6VJQ0_BCL2L10-01      a----gcaggtactgcagct--tcggagggaa-----acgagccggcgtc
F6ZMX1_MCL1-03         g----gcagtccttggagctcatcagccggtaccttcgcgagcaggcggt
F6ZMX1_MCL1-01         g----gcagtccttggagctcatcagccggtaccttcgcgagcaggcggt
F6ZMX1_MCL1-02         g----gcagtccttggagctcatcagccggtaccttcgcgagcaggcggt
                                    **                               *   

F6SFL4_BCL2A1-01       gttcataat----------gaacaatatagcagag---------------
F6YNL8_BCL2-01         gtacctgaa------ccggcacctgc--------------------acac
F6WA14_BCL2L1-01       ttacttgga------tgaccaccta--------------------gaccc
F6VJQ0_BCL2L10-01      tgac-cgaa--aaactctgcaactatctggtggagagg----aagggcgc
F6ZMX1_MCL1-03         tggcacgaaggaggccaagcccctacgcagcggcaaggccttagagaccc
F6ZMX1_MCL1-01         tggcacgaaggaggccaagcccctacgcagcggcaaggccttagagaccc
F6ZMX1_MCL1-02         tggcacgaaggaggccaagcccctacgcagcggcaaggccttagagaccc
                          *                  *                           

F6SFL4_BCL2A1-01       -tggataagacaaa-atggaggatgggaaa--------atggctttgtaa
F6YNL8_BCL2-01         ttggatccaggata-acggaggatggg-----------tag---------
F6WA14_BCL2L1-01       ttggatccaagaaa-atggcggctgggacacctttg--tggaactttatg
F6VJQ0_BCL2L10-01      gtggctgcatgaga-acggaggctgga-----------ctggctttcacc
F6ZMX1_MCL1-03         tgcgacgcgtgggagacggtgtccagaggaaccacgagagggctttccaa
F6ZMX1_MCL1-01         tgcgacgcgtgggagacggtgtccagaggaaccacgagagggctttccaa
F6ZMX1_MCL1-02         tgcgacgcgtgggagacggtgtccagaggaaccacgagagggctttccaa
                          *         * * ** *    *              *         

F6SFL4_BCL2A1-01       agaactttgaacctaatacagtgtggccgaacttcacag-----------
F6YNL8_BCL2-01         --------------------------------------------------
F6WA14_BCL2L1-01       ggaa---tgatgcagctgcagagagccggaagggccagga----------
F6VJQ0_BCL2L10-01      acca-----cttcgaaaaaaggcaatctcctccaccaa------------
F6ZMX1_MCL1-03         ggca---tgcttcggaaattgg--atatcaaaaacgaagaggatattaaa
F6ZMX1_MCL1-01         ggca---tgcttcggaaattgg--atatcaaaaacgaagaggatattaaa
F6ZMX1_MCL1-02         ggca---tgcttcggaaattgg--atatcaaaaacgaagaggatattaaa
                                                                         

F6SFL4_BCL2A1-01       ---atatttcaacaaag-----------------------------atct
F6YNL8_BCL2-01         ---gtgcct-----------------------------------------
F6WA14_BCL2L1-01       ---acgcttcaaccgatggc-tgctgactggcatgacagt------ggcc
F6VJQ0_BCL2L10-01      ---gtgactcaagtaataatacactgtgctgcataatggc------agca
F6ZMX1_MCL1-03         gctgtgtctcgagtggcgaccca-tgttttcagtgacggtataacaaact
F6ZMX1_MCL1-01         gctgtgtctcgagtggcgaccca-tgttttcagtgacggtataacaaact
F6ZMX1_MCL1-02         gctgtgtctcgagtggcgaccca-tgttttcagtgacggtataacaaact
                               *                                         

F6SFL4_BCL2A1-01       ggggcat----------attttcctttct---------------------
F6YNL8_BCL2-01         -----ag-------------------------------------------
F6WA14_BCL2L1-01       ggtgtagtcctgctggggtccctattc-----------------------
F6VJQ0_BCL2L10-01      gcagcag---gatttggact------------------------------
F6ZMX1_MCL1-03         ggggcag---gattgtgactctcatttctttcggtgcctttgtggcaaag
F6ZMX1_MCL1-01         ggggcag---gattgtgactctcatttctttcggtgcctttgtggcaaag
F6ZMX1_MCL1-02         ggggcag---gattgtgactctcatttctttcggtgcctttgtggcaaag
                            *                                            

F6SFL4_BCL2A1-01       --------------------------------------------------
F6YNL8_BCL2-01         --------------------------------------------------
F6WA14_BCL2L1-01       --------------------------------------------------
F6VJQ0_BCL2L10-01      --------------------------------------------------
F6ZMX1_MCL1-03         cacttgaagagcataaaccaggaaagttgcatagacccgctagcagaaag
F6ZMX1_MCL1-01         cacttgaagagcataaaccaggaaagttgcatagacccgctagcagaaag
F6ZMX1_MCL1-02         cacttgaagagcataaaccaggaaagttgcatagacccgctagcagaaag
                                                                         

F6SFL4_BCL2A1-01       --------------------------------------------------
F6YNL8_BCL2-01         --------------------------------------------------
F6WA14_BCL2L1-01       --------------------------agccgga-----------------
F6VJQ0_BCL2L10-01      --------------------------agtgggattagct-----------
F6ZMX1_MCL1-03         cataacagatgttctggtcaagacaaaacgggactggctgattaagcaaa
F6ZMX1_MCL1-01         cataacagatgttctggtcaagacaaaacgggactggctgattaagcaaa
F6ZMX1_MCL1-02         cataacagatgttctggtcaagacaaaacgggactggctgattaagcaaa
                                                                         

F6SFL4_BCL2A1-01       --------------------------------------------------
F6YNL8_BCL2-01         --------------------------------------------------
F6WA14_BCL2L1-01       --------------------------------------------------
F6VJQ0_BCL2L10-01      --------------------------------------------------
F6ZMX1_MCL1-03         agggctgggagggatttgtggaattctttcatgtacaggacctagaaggt
F6ZMX1_MCL1-01         agggctggaaagg------------cctccttgctcaagacacggaagaa
F6ZMX1_MCL1-02         agggctggtcag-------------------------------ggaagga
                                                                         

F6SFL4_BCL2A1-01       --------------------------------------------------
F6YNL8_BCL2-01         --------------------------------------------------
F6WA14_BCL2L1-01       --------------------------------------------------
F6VJQ0_BCL2L10-01      --------------------------------------------------
F6ZMX1_MCL1-03         ggcatcagaaatg-------------------------------------
F6ZMX1_MCL1-01         gccacccgaaccggcgatccctgcgccccctcctcggcatacctcctcct
F6ZMX1_MCL1-02         gagagtggatcca-------------------------------------
                                                                         

F6SFL4_BCL2A1-01       --------------------------------------------------
F6YNL8_BCL2-01         --------------------------------------------------
F6WA14_BCL2L1-01       --------------------------------------------------
F6VJQ0_BCL2L10-01      ------------cttttattagtcgtac----------------------
F6ZMX1_MCL1-03         ---tgctgctcgcctttgccggtgttgctggagta-ggagctggtttggc
F6ZMX1_MCL1-01         ctgcgcagaacccttgttctggtggtgccagctcacagcatcgggctgtc
F6ZMX1_MCL1-02         ------agaggccttgt---------------------------------
                                                                         

F6SFL4_BCL2A1-01       -----------------------------------gaagtaa--------
F6YNL8_BCL2-01         --------------------------------------------------
F6WA14_BCL2L1-01       -------------------------------------agtga--------
F6VJQ0_BCL2L10-01      -------------------------------------gataa--------
F6ZMX1_MCL1-03         atat--------------------------ctaataagatag--------
F6ZMX1_MCL1-01         atgttccggataagcccaggaatgtgcttactgaggagagaaaatgggct
F6ZMX1_MCL1-02         ------------------------------ctcaggaggaaa--------
                                                                         

F6SFL4_BCL2A1-01       --------------------------------------------------
F6YNL8_BCL2-01         --------------------------------------------------
F6WA14_BCL2L1-01       --------------------------------------------------
F6VJQ0_BCL2L10-01      --------------------------------------------------
F6ZMX1_MCL1-03         --------------------------------------------------
F6ZMX1_MCL1-01         gcctcgctgcaacgttctcacaacaaattctccacttcaatgataactca
F6ZMX1_MCL1-02         --------------------------------------------------
                                                                         

F6SFL4_BCL2A1-01       ----------
F6YNL8_BCL2-01         ----------
F6WA14_BCL2L1-01       ----------
F6VJQ0_BCL2L10-01      ----------
F6ZMX1_MCL1-03         ----------
F6ZMX1_MCL1-01         tggactctag
F6ZMX1_MCL1-02         ------ctga
                                 

© 1998-2020Legal notice