Dataset for CDS BCL-2-like of organism Monodelphis domestica

[Download (right click)] [Edit] [Sequences] [Repertoires]

8 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


F6SFL4_BCL2A1-01        atg-----------------------------------------------
F6YNL8_BCL2-01          atgatggctcaccctggaagaag----------------aggatatgata
F6VJQ0_BCL2L10-01       atgg------attacaag-------------------------tgtgctc
A0A5F8GAQ2_MCL1-02      atgttaggccctttcaagaagaacgccgtcatcggcctcaacctttactg
A0A5F8GAQ2_MCL1-01      atgttaggccctttcaagaagaacgccgtcatcggcctcaacctttactg
F6WA14_BCL2L1-01        atgt----------------------cg--------------cacag-ta
A0A5F8HG85_BCL2L2-      atgg----------------------cgactccagcctcagccccagata
A0A5F8HG85_BCL2L2-      atgg----------------------cgactccagcctcagccccagata
                        ***                                               

F6SFL4_BCL2A1-01        --------------------------------------------------
F6YNL8_BCL2-01          a-------ccggga------------------------------------
F6VJQ0_BCL2L10-01       t-------taggga--------agagacggcg----------------cg
A0A5F8GAQ2_MCL1-02      tggcggggcagggatgggcgccggcggcggcgccagcggtcccccgtccg
A0A5F8GAQ2_MCL1-01      tggcggggcagggatgggcgccggcggcggcgccagcggtcccccgtccg
F6WA14_BCL2L1-01        a-------ccggga------------------------------------
A0A5F8HG85_BCL2L2-      c-------tcgagc------------------------------------
A0A5F8HG85_BCL2L2-      c-------tcgagc------------------------------------
                                                                          

F6SFL4_BCL2A1-01        gatgattacgagttccatta---------------tgttcacatgtt---
F6YNL8_BCL2-01          gatagtgatgaaatacat-----------------tcattataaactgtc
F6VJQ0_BCL2L10-01       gctggtaactgactacct----------------------ggaatatt--
A0A5F8GAQ2_MCL1-02      gcgggcgcctg-ctagcttctggcaaaggccctacggttgagagtactcc
A0A5F8GAQ2_MCL1-01      gcgggcgcctg-ctagcttctggcaaaggccctacggttgagagtactcc
F6WA14_BCL2L1-01        gctggtgattgactttct-----------------ttcttacaagctctc
A0A5F8HG85_BCL2L2-      cctggtggcagattttgt-----------------gggttacaagctgag
A0A5F8HG85_BCL2L2-      cctggtggcagattttgt-----------------gggttacaagctgag
                                     *   *                        *       

F6SFL4_BCL2A1-01        ----------------------------------------agctcgggac
F6YNL8_BCL2-01          acagagggggtacgagtgggat---------------------gctggag
F6VJQ0_BCL2L10-01       --------------------------------------------------
A0A5F8GAQ2_MCL1-02      gccgcagcgcgatggaggggaagtggaaacagggacggcgggggcagggt
A0A5F8GAQ2_MCL1-01      gccgcagcgcgatggaggggaagtggaaacagggacggcgggggcagggt
F6WA14_BCL2L1-01        acagaaaggatacaattggagtcagtttgaagatgagaacaggactgagg
A0A5F8HG85_BCL2L2-      gcagaagggctatgcctg---------------------tggaactgg--
A0A5F8HG85_BCL2L2-      gcagaagggctatgcctg---------------------tggaactgg--
                                                                          

F6SFL4_BCL2A1-01        tacttgaagcat--------------------------------------
F6YNL8_BCL2-01          atctgagggcaccagcctctccaagtcttcctcctgttgttgcttctg--
F6VJQ0_BCL2L10-01       --gttgccggaggga--------------------------------agg
A0A5F8GAQ2_MCL1-02      tgattggcggaggaatccgtgcgagtcctccgaat-cctgtctcgccggg
A0A5F8GAQ2_MCL1-01      tgattggcggaggaatccgtgcgagtcctccgaat-cctgtctcgccggg
F6WA14_BCL2L1-01        ttctagaaggggcagagatacctagtactgtgaatggcagtccctcttgg
A0A5F8HG85_BCL2L2-      -cccaggagagg--------------------------------------
A0A5F8HG85_BCL2L2-      -cccaggagagg--------------------------------------
                                *                                         

F6SFL4_BCL2A1-01        -gttcaacagacaccacca------------------------------c
F6YNL8_BCL2-01          -cccctgctgttggaatcttctctacccagccacgaaacacaccattgcc
F6VJQ0_BCL2L10-01       cgtccaggagct-gc-cggcccctaccc---------------------c
A0A5F8GAQ2_MCL1-02      cgcccggggggtcgcgcggcccgcaccca--------------------t
A0A5F8GAQ2_MCL1-01      cgcccggggggtcgcgcggcccgcaccca--------------------t
F6WA14_BCL2L1-01        caccctgctgacagc----------cgtg--------------------c
A0A5F8HG85_BCL2L2-      -gccct--------------------------------------------
A0A5F8HG85_BCL2L2-      -gccct--------------------------------------------
                            *                                             

F6SFL4_BCL2A1-01        tgggatcatgtctaaataagacatctcaaatac-----------------
F6YNL8_BCL2-01          tgctgctgctgctgctggacctaccgtcagtcc-----------------
F6VJQ0_BCL2L10-01       tgctgcag----------ctacactgc--gttt-----------------
A0A5F8GAQ2_MCL1-02      tggcgcggaggcccccgacgtcaccaccgatcc-----------------
A0A5F8GAQ2_MCL1-01      tggcgcggaggcccccgacgtcaccaccgatcc-----------------
F6WA14_BCL2L1-01        tgtgagtggggccacagggcacagcagcagcctggatgcccatgagacaa
A0A5F8HG85_BCL2L2-      --------------------acaacagagccct-----------------
A0A5F8HG85_BCL2L2-      --------------------acaacagagccct-----------------
                                              *                           

F6SFL4_BCL2A1-01        ---------------tacaaaaggtt--------------gctttctctg
F6YNL8_BCL2-01          -agtgccacctgtggtccacctgact-------------------cttcg
F6VJQ0_BCL2L10-01       -----------ggtgtcgagcgagct------------------------
A0A5F8GAQ2_MCL1-02      -----------gatgccgagcctgttcgcgccgggccgctgctcgtcggc
A0A5F8GAQ2_MCL1-01      -----------gatgccgagcctgttcgcgccgggccgctgctcgtcggc
F6WA14_BCL2L1-01        taccagtggctgctgtgaagcaagct-------------------ttgag
A0A5F8HG85_BCL2L2-      ---------------tgcaccgggcc-------------------atgcg
A0A5F8HG85_BCL2L2-      ---------------tgcaccgggcc-------------------atgcg
                                          *                               

F6SFL4_BCL2A1-01        tccaacaagaagtagaaaaggatatgg----aaacatgcttgagcacttt
F6YNL8_BCL2-01          tcaagctggagatg--------atttctctagaaggtaccggagagactt
F6VJQ0_BCL2L10-01       --ccgccagatttacc---aggacttc---------ttcgagtgcgccct
A0A5F8GAQ2_MCL1-02      gcccgccgaggtggccgatggggctgc----ggacgtcccaatgtgccct
A0A5F8GAQ2_MCL1-01      gcccgccgaggtggccgatggggctgc----ggacgtcccaatgtgccct
F6WA14_BCL2L1-01        ggaggcaggagatg-aatttgaacttc----gg---tacaggcgggcatt
A0A5F8HG85_BCL2L2-      tgctgctggagacg-agtttgagtccc----gc---tttcgacgcacatt
A0A5F8HG85_BCL2L2-      tgctgctggagacg-agtttgagtccc----gc---tttcgacgcacatt
                             *                              *      *     *

F6SFL4_BCL2A1-01        gg-----------------------acatcgtttctgtagagt-------
F6YNL8_BCL2-01          tg--atgaaatgtcaggtcaactgcacctgacccctgtta----------
F6VJQ0_BCL2L10-01       ga--atcagctactcgaccgggaacctgagc--------aagtaatcgt-
A0A5F8GAQ2_MCL1-02      gaggaggaactggacggttacgagcccgagcctcccgggaagcggccctc
A0A5F8GAQ2_MCL1-01      gaggaggaactggacggttacgagcccgagcctcccgggaagcggccctc
F6WA14_BCL2L1-01        ca--gtgacctgacatcccagctccacatcacgccaggaa----------
A0A5F8HG85_BCL2L2-      tt--ctgatctggccgctcagttgcatgtgactcctggct----------
A0A5F8HG85_BCL2L2-      tt--ctgatctggccgctcagttgcatgtgactcctggct----------
                                                                          

F6SFL4_BCL2A1-01        ctgccagaagaattttcaatagtgttatgaagaaggaatttgaggatggc
F6YNL8_BCL2-01          ctgctaggggacgctttgccacagtggtagaggagctgttcagggatggg
F6VJQ0_BCL2L10-01       caacgtagcggagct---catgg----------------accgaggcgag
A0A5F8GAQ2_MCL1-02      ccgcctggctgtgctggaaatag----------------cccgggaagg-
A0A5F8GAQ2_MCL1-01      ccgcctggctgtgctggaaatag----------------cccgggaagg-
F6WA14_BCL2L1-01        cagcttatcagagctttgagcaggtagtgaatgaactcttccgggatggg
A0A5F8HG85_BCL2L2-      cggctcagcagcgctttacccaggtctcagatgagctcttccaagggggg
A0A5F8HG85_BCL2L2-      cggctcagcagcgctttacccaggtctcagatgagctcttccaagggggg
                        *  *          *                             *  *  

F6SFL4_BCL2A1-01        gtcattaactggggacggattgtcaccatatttgcttttgggggaattct
F6YNL8_BCL2-01          gtg---aactgggggaggatcgtggccttctttgagtttggtggtgt---
F6VJQ0_BCL2L10-01       ttc---aactggggccgggtggcggtgctagtggtttttgccggggc---
A0A5F8GAQ2_MCL1-02      ---------tggggacagcccgaacggctctttgccttcgacgccgcccc
A0A5F8GAQ2_MCL1-01      ---------tggggacagcccgaacggctctttgccttcgacgccgcccc
F6WA14_BCL2L1-01        gtg---aactggggccgaattgtggcattcttctccttcggaggggc---
A0A5F8HG85_BCL2L2-      ccc---aactggggccgtcttgtggcattcttcgtctttggggcagc---
A0A5F8HG85_BCL2L2-      ccc---aactggggccgtcttgtggcattcttcgtctttggggcagc---
                                 *****       *      *  *    ** *  *       

F6SFL4_BCL2A1-01        ca-----------tcaagaagcttctgagacatagagctccactgactat
F6YNL8_BCL2-01          --tatgtg-----tgtggagagcgtcaaccgggagat----gtcgcccct
F6VJQ0_BCL2L10-01       --gctgctggagatggaggaactactgaa--agagga----gcaggtact
A0A5F8GAQ2_MCL1-02      cagctgaggaggatgaagaagaggatgaactatacgg----gcagtcctt
A0A5F8GAQ2_MCL1-01      cagctgaggaggatgaagaagaggatgaactatacgg----gcagtcctt
F6WA14_BCL2L1-01        --attgtg-----tgtggaaagcgtggataaggagat----ggaagtctt
A0A5F8HG85_BCL2L2-      --gctctg-----tgcagagagtgtcaacaaagagat----ggagccact
A0A5F8HG85_BCL2L2-      --gctctg-----tgcagagagtgtcaacaaagagat----ggagccact
                                     *   *         *     *               *

F6SFL4_BCL2A1-01        gggcactcaggaagaaatttctcattttattgccgagttcataat-----
F6YNL8_BCL2-01          gg------tggacagcattgccctatggatgactgagtacctgaa-----
F6VJQ0_BCL2L10-01       gcagct--tcggagggaa-----acgagccggcgtctgac-cgaa--aaa
A0A5F8GAQ2_MCL1-02      ggagctcatcagccggtaccttcgcgagcaggcggttggcacgaaggagg
A0A5F8GAQ2_MCL1-01      ggagctcatcagccggtaccttcgcgagcaggcggttggcacgaaggagg
F6WA14_BCL2L1-01        gg------taggacgcatcacctcctggatggccacttacttgga-----
A0A5F8HG85_BCL2L2-      gg------tgggacaggtgcaggactggatggtgacctacctaga-----
A0A5F8HG85_BCL2L2-      gg------tgggacaggtgcaggactggatggtgacctacctaga-----
                        *                                      *          

F6SFL4_BCL2A1-01        -----gaacaatatagcagagtggataagacaaaatggagga---tggga
F6YNL8_BCL2-01          -----ccggcacctgcacacttggatccaggataacggagg---------
F6VJQ0_BCL2L10-01       ctctgcaactatctggtggagagg----aagggcgcgtggctgcatgaga
A0A5F8GAQ2_MCL1-02      ccaagcccctacgcagcggcaaggccttagagaccctgcgacgcgtggga
A0A5F8GAQ2_MCL1-01      ccaagcccctacgcagcggcaaggccttagagaccctgcgacgcgtggga
F6WA14_BCL2L1-01        -----tgaccacctagacccttggatccaagaaaatggcggc---tggga
A0A5F8HG85_BCL2L2-      -----gacacagctggcagactggatccacagcagtgggggc---tggga
A0A5F8HG85_BCL2L2-      -----gacacagctggcagactggatccacagcagtgggggc---tggga
                                  *           **               *          

F6SFL4_BCL2A1-01        --------------------------------------------------
F6YNL8_BCL2-01          --------------------------------------------------
F6VJQ0_BCL2L10-01       -acggaggctgga-----------ctgg----------------------
A0A5F8GAQ2_MCL1-02      gacggtgtccagaggaaccacgagaggg----------------------
A0A5F8GAQ2_MCL1-01      gacggtgtccagaggaaccacgagaggg----------------------
F6WA14_BCL2L1-01        --------------------------------------------------
A0A5F8HG85_BCL2L2-      gctggaggccatcaaagcccgagtaagggagatggaggaagaggcagaga
A0A5F8HG85_BCL2L2-      gctggaggccatcaaagcccgagtaagggagatggaggaagaggcagaga
                                                                          

F6SFL4_BCL2A1-01        --------------------------------------------------
F6YNL8_BCL2-01          --------------------------------------------------
F6VJQ0_BCL2L10-01       ------------------------------------------------ct
A0A5F8GAQ2_MCL1-02      ------------------------------------------------ct
A0A5F8GAQ2_MCL1-01      ------------------------------------------------ct
F6WA14_BCL2L1-01        ------------------------------------------------ca
A0A5F8HG85_BCL2L2-      aattgaaggagcttcagaacgaggtggagaaacagatgaacatgagtcca
A0A5F8HG85_BCL2L2-      aattgaaggagcttcagaacgaggtggagaaacagatgaacatgagtcca
                                                                          

F6SFL4_BCL2A1-01        -------------------aaatgg-------------------------
F6YNL8_BCL2-01          --------------------------------------------------
F6VJQ0_BCL2L10-01       ttcaccacca--cttcgaaaaaaggcaatctcctccaccaa---------
A0A5F8GAQ2_MCL1-02      ttccaaggcatgcttcggaaattgg--atatcaaaaacgaagaggatatt
A0A5F8GAQ2_MCL1-01      ttccaaggcatgcttcggaaattgg--atatcaaaaacgaagaggatatt
F6WA14_BCL2L1-01        cct-------------------------------ttgtggaa--------
A0A5F8HG85_BCL2L2-      cccccaggcaatgctggcccagtgatcatgtccattgaggagaagatgga
A0A5F8HG85_BCL2L2-      cccccaggcaatgctggcccagtgatcatgtccattgaggagaagatgga
                                                                          

F6SFL4_BCL2A1-01        -------------------------------ctttgta------------
F6YNL8_BCL2-01          --------------------------------------------------
F6VJQ0_BCL2L10-01       ------gtgactcaagtaataatacactgtgctgcata------------
A0A5F8GAQ2_MCL1-02      aaagctgtgtctcgagtggcgaccca-tgttttcagtg------------
A0A5F8GAQ2_MCL1-01      aaagctgtgtctcgagtggcgaccca-tgttttcagtg------------
F6WA14_BCL2L1-01        -------------------------------ctttatggga---------
A0A5F8HG85_BCL2L2-      -------------ggctgatgcccgatccatctatgtaggcaatgtggac
A0A5F8HG85_BCL2L2-      -------------ggctgatgcccgatccatctatgtaggcaatgtggac
                                                                          

F6SFL4_BCL2A1-01        -aagaactttgaacctaatacagtgtggccgaact---------------
F6YNL8_BCL2-01          -atgg--------------gtag---------------------------
F6VJQ0_BCL2L10-01       -atggc------agcagcagcag--gatttggact---------------
A0A5F8GAQ2_MCL1-02      -acggtataacaaactggggcag--gattgtgactctcatttctttcggt
A0A5F8GAQ2_MCL1-01      -acggtataacaaactggggcag--gattgtgactctcatttctttcggt
F6WA14_BCL2L1-01        -atgat-------gcagctgcag-agagccggaag---------------
A0A5F8HG85_BCL2L2-      tatggt-------gcaacagcagaagagctggaggcacacttccatggtt
A0A5F8HG85_BCL2L2-      tatggt-------gcaacagcagaagagctggaggcacacttccatggtt
                         * *                 **                           

F6SFL4_BCL2A1-01        --------------------------------------------------
F6YNL8_BCL2-01          --------------------------------------------------
F6VJQ0_BCL2L10-01       --------------------------------------------------
A0A5F8GAQ2_MCL1-02      gcctttgtggcaaagcacttgaagagcataaaccaggaaagttgcataga
A0A5F8GAQ2_MCL1-01      gcctttgtggcaaagcacttgaagagcataaaccaggaaagttgcataga
F6WA14_BCL2L1-01        --------------------------------------------------
A0A5F8HG85_BCL2L2-      gtggttcagttaatcgagttaccatcctttgtgacaagttcagtggccat
A0A5F8HG85_BCL2L2-      gtggttcagttaatcgagttaccatcctttgtgacaagttcagtggccat
                                                                          

F6SFL4_BCL2A1-01        --------------------------------------------------
F6YNL8_BCL2-01          --------------------------------------------------
F6VJQ0_BCL2L10-01       -----------------------------------------agt------
A0A5F8GAQ2_MCL1-02      cccgctagcagaaagcataacagatgttctggtcaagacaaaac------
A0A5F8GAQ2_MCL1-01      cccgctagcagaaagcataacagatgttctggtcaagacaaaac------
F6WA14_BCL2L1-01        --------------------------------------------------
A0A5F8HG85_BCL2L2-      cctaaggggtttgcatatatagaattttcagataaagattcagtcaggac
A0A5F8HG85_BCL2L2-      cctaaggggtttgcatatatagaattttcagataaagattcagtcaggac
                                                                          

F6SFL4_BCL2A1-01        --------tcacagatatttc-----------------------------
F6YNL8_BCL2-01          ------gtgcctag------------------------------------
F6VJQ0_BCL2L10-01       ------gggattagctctttt-----------------------------
A0A5F8GAQ2_MCL1-02      ------gggactggctgatta-----------------------------
A0A5F8GAQ2_MCL1-01      ------gggactggctgatta-----------------------------
F6WA14_BCL2L1-01        ------ggccaggaacgcttc-----------------------------
A0A5F8HG85_BCL2L2-      gtcgatggccttggatgattctcttttcagaggaagacagatcaaagtga
A0A5F8HG85_BCL2L2-      gtcgatggccttggatgattctcttttcagaggaagacagatcaaagtga
                                                                          

F6SFL4_BCL2A1-01        ----------aacaaagatctggggcat----------------------
F6YNL8_BCL2-01          --------------------------------------------------
F6VJQ0_BCL2L10-01       ----------attag-----------------------------------
A0A5F8GAQ2_MCL1-02      ----------agcaaaagggctggtcag-------------------gga
A0A5F8GAQ2_MCL1-01      ----------agcaaaagggctggaaaggcctccttgctcaagacacgga
F6WA14_BCL2L1-01        ----------aaccgat-ggctgctgac-------------tggcatgac
A0A5F8HG85_BCL2L2-      taccaaaacggaccaataggccggggat-------------cagcaccac
A0A5F8HG85_BCL2L2-      taccaaaacggaccaataggccggggat-------------cagcaccac
                                                                          

F6SFL4_BCL2A1-01        --------------------------------------------------
F6YNL8_BCL2-01          --------------------------------------------------
F6VJQ0_BCL2L10-01       --------------------------------------------------
A0A5F8GAQ2_MCL1-02      aggagagagtggatcca---------------------------------
A0A5F8GAQ2_MCL1-01      agaagccacccgaaccggcgatccctgcgccccctcctcggcatacctcc
F6WA14_BCL2L1-01        a----------------gtggccggtgtagtcctgctgggg---------
A0A5F8HG85_BCL2L2-      agatcggggttttccacgtgcccgatatcg---tgccagggctactaact
A0A5F8HG85_BCL2L2-      agatcggggttttccacgtgcccgatatcg---tgccagggctactaact
                                                                          

F6SFL4_BCL2A1-01        ------------attttcctttctgaag----------------------
F6YNL8_BCL2-01          --------------------------------------------------
F6VJQ0_BCL2L10-01       -----------------tcgt-----------------------------
A0A5F8GAQ2_MCL1-02      ----------agaggccttgt-----------------------------
A0A5F8GAQ2_MCL1-01      tcctctgcgcagaacccttgttctggtggtgccagctcacagcatcgggc
F6WA14_BCL2L1-01        --------------tccctattc---------------------------
A0A5F8HG85_BCL2L2-      acagtagttcacgctctcgattctatagcggcttcaacagcagaccccgg
A0A5F8HG85_BCL2L2-      acagtagttcacgctctcgattctatagcggcttcaacagcagaccccgg
                                                                          

F6SFL4_BCL2A1-01        --------------------------------------------------
F6YNL8_BCL2-01          --------------------------------------------------
F6VJQ0_BCL2L10-01       --------------------------------------------------
A0A5F8GAQ2_MCL1-02      ----------------------------------ctcaggaggaaa----
A0A5F8GAQ2_MCL1-01      tgtcatgttccggataagcccaggaatgtgcttactgaggagagaaaatg
F6WA14_BCL2L1-01        ---------------agccgg----aagtga-------------------
A0A5F8HG85_BCL2L2-      ggccgagtctacaggggccgggctagagcgacgtcatggtattcccc---
A0A5F8HG85_BCL2L2-      ggccgagtctacaggggccgggctagagcgacgtcatggt------t---
                                                                          

F6SFL4_BCL2A1-01        --------------------------------------------------
F6YNL8_BCL2-01          --------------------------------------------------
F6VJQ0_BCL2L10-01       --------------------------------------------------
A0A5F8GAQ2_MCL1-02      --------------------------------------------------
A0A5F8GAQ2_MCL1-01      ggctgcctcgctgcaacgttctcacaacaaattctccacttcaatgataa
F6WA14_BCL2L1-01        --------------------------------------------------
A0A5F8HG85_BCL2L2-      --------------------------------------------------
A0A5F8HG85_BCL2L2-      --------------------------------------------------
                                                                          

F6SFL4_BCL2A1-01        -----------taa
F6YNL8_BCL2-01          --------------
F6VJQ0_BCL2L10-01       -------acgataa
A0A5F8GAQ2_MCL1-02      ----------ctga
A0A5F8GAQ2_MCL1-01      ctcatggactctag
F6WA14_BCL2L1-01        --------------
A0A5F8HG85_BCL2L2-      -------ttactaa
A0A5F8HG85_BCL2L2-      -------tctgtag
                                      

© 1998-2020Legal notice