Dataset for CDS BCL-2-like of organism Salmo trutta

[Download (right click)] [Alignment] [Repertoires]

14 sequence(s)

>gnl|bcl2dbcds|A0A673VWA7_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Salmo trutta GN=MCL-1 (length=858 residues).
atgagtctgtcgaactcgattacacgagccacaactacgatgttgcattttcaaaatggaggatcttcgtacctagctga
tgatgctaggccgttgtactatttccacggggctggggccatatgtgctggggcgtcaccgaagtctaaagtggacatgg
gaaatgggactggcgatactccaccacgacccacgacgttaggagtgaatgtcgtgaaaagcaacggcctcgataatcat
ttgtcagaccgaagcaacaatgacgactctttgccgtgcactccccagatggcgtcagaatgtgggcctgaactatcgaa
ttgtccatcgggcgatgaagtattggaagatgataccagacaactcattgagaattttttgggggactacacaggactgt
ctcaccctcgatggaaacaaagcaagcctcttacgacgatgaagcgagtggtggaggacgtaatagcaaagcaccgatac
gcatacaatggtatggtcgccaaacttgacttggatgaccgatgcgatgacatgggcgtcatcaattctgtggccaagac
catgttcagtgatgggatcacaaactggggtcgcatcgccagcctggtggcatttggagcagtggtgagccagcacctga
aggagaggggcaggggacactgcgttgagttggtgggccaagagattgccaaatatctcctctctgaccaaagtgactgg
ctgatcaaaaacaatgcttggaatggatttgtagagttctttcatgtacaagatcctgagtcctcagtaaggaacaccct
cctagccattgctggagttgctgggattggggcaacactcgccatgttcatcaggtga
>gnl|bcl2dbcds|A0A673Z0A3_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Salmo trutta GN=BCL-2 (length=693 residues).
atgatggcgaacgataatccttataacagtcgctttattgttgaaaaatacatccatcacaaactgttgaagaagggatt
tgtatgggaatttaatccagaaaacgattccccaaataatggctttggggagccctctccccctaactcccctgaagttt
ttgcacggaggtcccagccctccgctgaaggtgtggacactgaatctcagctcccaaacaggatcccgcaaccggaccga
catgcccggctccatagggtgctgcgcgaggcgggggacgagattgaaataatgtatcagcgggactttgcagagatgtc
ggggcagttgcattttacgcccagtacagcacagagaaggtttactgctgtaatagaggagctcttccgcgacggtgtaa
actggggtcggattgtggctttctttgagtttggagggacaatgtgcgtggagagcgtcaaccgggagatgacgacccag
gtagacaacattgcccattggatgacagagtacctgaacggacccctgcagaactggatccaggagaatggtgactggga
cgcctttgtggagatctatgggcagcagaggatctctgtcttccactcctggccctacctaaagacagtgttcggcctgg
ccgccctgggtgcagccggagtcaccattggagcgttgttcatccagaagtga
>gnl|bcl2dbcds|A0A673Z4J6_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Salmo trutta GN=BCL2L1 (length=651 residues).
atgtcttacagtaacagggaactggtggtgttttttataagctatagactgtcccagaggaattattcatgttgtcaatt
ggggctggagggtgcaagtggacggactgagggagatgaggccattgcaaatgggtctgtggggaacagcagaagcaact
tggcaaagccctcatctccacaggggggcatggagccagtgaaagcagcactacgggactcagtggatgagtttgagctg
cgctacacccgcgcctttagtgacctctcctcccagctccacatcacccctgccacagcctaccacagctttgagagtgt
gatggacgaagtgttcagggacggggtcaactggggtcgcgtggtgggtctgtttgctttcggcggggccttgtgtgttg
agtgtgttgagaaggatatgagcccactggtggcgcgcatcgcagactggatgaccacctacctggacaaccatatccag
ccctggatccagagccaaggaggatgggaccgttttgcagagatctttggcagagatgctgctgcagacgttcgacggtc
tcaggagagcataattaaatggctgctagctggggtgattctgctttcaggagtgctggtcggcactctcatcatgaaga
aacgtcagtga
>gnl|bcl2dbcds|A0A674B0E5_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Salmo trutta GN=BCL-2 (length=681 residues).
atggcaaacgacgacaaccgctttatagtggaaaagtacatttgtcacaaactcttgaaacgaggatatgcgtgggattt
cgaggatgccgaggaggaggaaggtgccgctaataatgggtcgatgatttctcctcggctgggtttggcacggcggtgcc
acggggccaataacgccggcccgggcagcgtccctagtctttccaaatggctctcccaaccggacccgcatgcagctatt
cacagagttttgcgtgaggccggggacgaactcgaaagactgtaccagcccgacttcgcagagatgtcacaccagctgta
tctcacatcctccacggctgagaggagatttagagaggtgatagacgagctgttcagggatggggttaactggggacgga
ttatcgccttcttcgagttcgggggcacaatatgcgtggaatgcgtgaacaaggagatgacgtcgcaggtggatcacatc
gcggtgtggatgacagagtatctaaatggaccactgctcagctggattcaggagaacgggggatgggaggcctttgttga
gctctatgacagacagagggactctgtgttctgttcgtggccgtccatcaagaccgtcttcggcctggctgcactggggg
ccgcaagccttaccatcggagcataccttacacagaagtga
>gnl|bcl2dbcds|A0A674B8T7_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Salmo trutta GN=BCL-2 (length=687 residues).
atgatggcaaacgagaatccttacaacagtcgctttattgtcgaaaaatacatccatcacaaactgttgaacatgggatt
tgtatggaaatttcaagcagaaaacgattctccaaataatggctttggggacccctctacacccaactcccccgaagttt
ttgcacggaggtcccagcccaccgccgcgggcgaggacaccgaccctccttaccaaaacaggagtccgcaacctgaccca
catgccaggctccacagggtcctgcgcgaggcgggtggcgagattgaaagaatgtatcagcgggactttgcagagatgtc
ggggcagttgcattttacacccagcacggcacagagaaggtttaccgctgtaatagatgagctcttcagcgacggggtaa
actggggtcggattgtggctttctttgagtttggagggacaatgtgcgtggagagcgtcaaccgggagatgacgtcccag
gtagacaacatcgctcgttggatgatggagtacttgaacggacccctacagaactggatccaggagaatggtggctggga
cgcctttgtggagatctatgagcagcagaggatctctcactcctggccgtacctaaagacagtgttcggcctggccgccc
tgggagccgctggagtcaccatcggagccttgttcacccagaagtga
>gnl|bcl2dbcds|A0A674C337_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Salmo trutta GN=BCL2L1 (length=687 residues).
atgatgacttacaacaacagagaactggtggtgtactatattacctataaactatcacagagggactaccccttcaacca
catggagctcacggaagcccagaatcggactgaggggggacaggtggaagggggtgctgcagtcataacatacgtcaacg
ggacgagtcccgggactccaccaccacggcagtcacccccctcctcccctcggcggacagcgggtctggatgcagtgaaa
gaggcattgcgggactctgccaacgagtttgagctgcgttatgccagagcgttcagtgacctgtcctcccagctacacat
cacgccgtccacagcctaccagagctttgagaacgtgatggacgaggtgttccgggacggtgtcaactggggacgggtgg
tgggcctgttttccttcggaggggccctctgtgtagaatgtgtggacaaggagatgaaccccttggtgggaaggatcaca
gactggatgaccgtctacctggacaaccacatccagccctggatccagagccaaggaggatgggaccggtttgcagagat
ctttgggatggacgctgcagccgagagcaggaagtctcaggagagctttaagaagtggcttctggcagggatgaccctgg
tcacaggagttgtcgttgggtcaatcttcgctcagaaacgcctgtga
>gnl|bcl2dbcds|A0A674C4N2_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Salmo trutta GN=BCL2L1 (length=660 residues).
atgtcttacagtaacagggaactggtggtgttttttataagctataaactgtcccagagaaattatccatgttgtcagtt
ggtgctggagggtgcaagtgggcggactgagggggatgaagccattgcaaatgggtctttgggaaacaacaggaacggca
gaagcaatttgggtaagccttcctctccacaggggggaattgaggcagtgaaagcagcactacgggactcagtggatgag
tttgagctgcgttacacccgcgccttcagtgacctctcctcccagctccacatcacccctgccacagcctaccacagctt
tgagagcgtgatggacgaagtgttcagggatggggtcaactggggtcgcgtggtgggcctgtttgctttcggcggggccc
tgtgcgttgagtgtgttgagaaggatatgagccacctggtgatgcgcatcgcagactggatggccacctacctggacaat
catatccagccctggatccagagccaaggaggatgggaccgttttgcggagatcttcggcagagatgcagctgcagacgt
ccgacggtcccaggagagcttaagaaaatggctgctagttggggtgatgctgctttcaggagtactggtcggcactctca
tcatgaagaaatgccagtga
>gnl|bcl2dbcds|A0A674C578_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Salmo trutta GN=BCL2L1 (length=693 residues).
atgtgtattaacctatctgaactggtggtatactatattacctataaactatcacagagagactaccccttcaaccacat
tgggctcacagaagctcccagtcggactgaggggggacaggcggaagggggggcggcagtcacgacacaccccaacggcg
cagcgaacgggacgagtcctgggactccaccgcgacagtctcccccctcgtcccctcagcggacaatgggcctggacgca
gtgaaagaggcattgcgggactctgccaacgagtttgagctgcgttatgccagagcgttcagtgacctgtcctcccagct
gcacatcacgccggccacagcctaccagagcttcgagaacgtgatggatgaggttttccgtgacggtgtgaactggggac
gtgtggtgggcctgtttgccttcggaggggccctctgtgtagagtgtgtggagaaagagatgagcccactagtgggacgg
attgcagactggatgactgtctacctggacaaccacatccagccctggatccagagccaaggaggatgggaccggtttgc
agaaatctttgggaaggacgctgcagctgagagcaggaagtcgcaggagagctttaagaagtggttgctggcggggatga
cgctggttaccggagtcatcgtagggtcactcattgctcagaaacgcctgtga
>gnl|bcl2dbcds|A0A674C578_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Salmo trutta GN=BCL2L1 (length=696 residues).
attatgacttacaacaacagagaactggtggtatactatattacctataaactatcacagagagactaccccttcaacca
cattgggctcacagaagctcccagtcggactgaggggggacaggcggaagggggggcggcagtcacgacacaccccaacg
gcgcagcgaacgggacgagtcctgggactccaccgcgacagtctcccccctcgtcccctcagcggacaatgggcctggac
gcagtgaaagaggcattgcgggactctgccaacgagtttgagctgcgttatgccagagcgttcagtgacctgtcctccca
gctgcacatcacgccggccacagcctaccagagcttcgagaacgtgatggatgaggttttccgtgacggtgtgaactggg
gacgtgtggtgggcctgtttgccttcggaggggccctctgtgtagagtgtgtggagaaagagatgagcccactagtggga
cggattgcagactggatgactgtctacctggacaaccacatccagccctggatccagagccaaggaggatgggaccggtt
tgcagaaatctttgggaaggacgctgcagctgagagcaggaagtcgcaggagagctttaagaagtggttgctggcgggga
tgacgctggttaccggagtcatcgtagggtcactcattgctcagaaacgcctgtga
>gnl|bcl2dbcds|A0A674D165_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Salmo trutta GN=MCL-1 (length=921 residues).
atgctgaggttccaaagcgggctgctagcattccccgagttcaagttgtactcgaatgttgggtacgttacaatcgcagg
tacaaaacattgcattatctgtgcatcgccaccaggccaagatcattacatcgcgtgccctgagattggtaacctcctca
aaacaaagttgaagcatctgaaactgtcagggtctatcgacagcactcctttgttcactaggagaggacccggacatgag
tacagctggggaggcctcgaacccgatagcgccttagcttacgacaccacaaacttcggtgtactccttccacatacggt
tgacacacacaaatgtttcatgtgtaacctcgaaatcaacaactttatatcacatcaggaaacataccatcaccagaccg
gagccctggacaccgacaccaggcaactcattaaatgtgtcctaggacaatgtacgggacttctgaaacctaggtggaac
gaaagcaaagctctgtcaacaatgagtagagttgttggtcaattactggagaagcacagatacacatacaatggtatgat
caacacactctatgtggatgacagaggggatgacgtgaagttcctcagtgcagtagcccatatcatctttcaagacggga
ccgtcaactggggccgtgttgccagcctgacatcttttggagctgcggtgtgccagtacttgaaagacaaggggagagac
aactgtgtggaggtggcgggagaggagatatcagcgtacctggtcacacaccacaaggactggctagtcaaacataactc
ctggaatgggttcgtggagttctttccagtagcagaaccggagtccagatctaggaacattattatgacccctgttggat
tggctggtattggagcagcaatgaccttgttggttatgtga
>gnl|bcl2dbcds|A0A674D1T7_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Salmo trutta GN=MCL-1 (length=558 residues).
tcaccgaatcggcttacggcgccctcaccatccagggaaggtacctaccctccgagggacatcacccgcaactcattaaa
tggacaatgtacgggacttctgaaacctaggtggaacgaaagcaaagctctgtcaacaatgagtagagttgttggtcaat
tactggagaagcacagatacacatccaatggtatgatcaacacactctatgtggatgacagaggggatgacgtgaagttc
ctcagtgcagtaacccatatcatctttcaagacgggaccgtcaactggggccgtgttgccagcctgacatcttttggagc
tgcggtgtgccagtacttgaaagacaaggggagagacaactgtgtggaggtggcgggagaggagatatcagcatacctgg
tcactcaccacaaggactggctagtcaaacataactcctggaatgggttcgtggagttctatccagtagcagaaccggag
tccagatctaggaacattattattacccttgttggattggctggtattggagcagcaatgaccttgttggttatgtga
>gnl|bcl2dbcds|A0A674ELG3_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Salmo trutta GN=MCL-1 (length=903 residues).
atgagtctgtcgtttacacgagccacaactacgattttgaattttcaaaatggagtcgtcggaggctcttcgtaccctgc
tggtacccctttgtgctatttcggcgagactgtatgtgctggggcgtcaccgaagtcaaaagtggatactgacttgggta
atgggactggcgacaccccaccacgacccacgaagttaggagtgaatgtcgtgaaaagcaacgtccagggtaatcatatc
tcagaccgaagcaacgatgacgactctgacggttctttgccgtgcactccacagatggcgtcagaatgtgggcctgaact
atcgaattgtccatcgggcgatgaagtattagaacatgatacaagacaactaattgaaaacttattgggggactatacag
gactgtctccgcctcgttggaagcaaagcaaggctcttacgacgatgacgcgagtggtgaaggatataattgcgaagcac
caatacgcatacaatggtatgatcgccaaacttgaactcgatgaccgaagcgacgacatgagtttcatcaattctgtggc
caagaccctgttcagtgatgggaccaccaactggggtcgcatcgccagcctggtggcatttggagcagtggtgagccagc
gcttgaaggagatgggcaggggacactgcattgagttggtgggccaaaatatcgccacatacctcctctctgaccaaagg
gactggctggtcaaaaacaatgcttggaatggatttgtagagttctttcatgtgcaagatccagagtcctcagtaaggaa
cgccctcatagcctttgctggatttgctgggcttggggcaacgctcgccatgttgatcagacagttccctgctcaacccc
aggggtgtgtggtgtgtttgtga
>gnl|bcl2dbcds|A0A674ELG3_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Salmo trutta GN=MCL-1 (length=867 residues).
atgagtctgtcgtttacacgagccacaactacgattttgaattttcaaaatggagtcgtcggaggctcttcgtaccctgc
tggtacccctttgtgctatttcggcgagactgtatgtgctggggcgtcaccgaagtcaaaagtggatactgacttgggta
atgggactggcgacaccccaccacgacccacgaagttaggagtgaatgtcgtgaaaagcaacgtccagggtaatcatatc
tcagaccgaagcaacgatgacgactctgacggttctttgccgtgcactccacagatggcgtcagaatgtgggcctgaact
atcgaattgtccatcgggcgatgaagtattagaacatgatacaagacaactaattgaaaacttattgggggactatacag
gactgtctccgcctcgttggaagcaaagcaaggctcttacgacgatgacgcgagtggtgaaggatataattgcgaagcac
caatacgcatacaatggtatgatcgccaaacttgaactcgatgaccgaagcgacgacatgagtttcatcaattctgtggc
caagaccctgttcagtgatgggaccaccaactggggtcgcatcgccagcctggtggcatttggagcagtggtgagccagc
gcttgaaggagatgggcaggggacactgcattgagttggtgggccaaaatatcgccacatacctcctctctgaccaaagg
gactggctggtcaaaaacaatgcttggaatggatttgtagagttctttcatgtgcaagatccagagtcctcagtaaggaa
cgccctcatagcctttgctggatttgctgggcttggggcaacgctcgccatgttgatcagaaattaa
>gnl|bcl2dbcds|A0A674ELG3_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Salmo trutta GN=MCL-1 (length=876 residues).
atgagtctgtcgtttacacgagccacaactacgattttgaattttcaaaatggagtcgtcggaggctcttcgtaccctgc
tggtacccctttgtgctatttcggcgagactgtatgtgctggggcgtcaccgaagtcaaaagtggatactgacttgggta
atgggactggcgacaccccaccacgacccacgaagttaggagtgaatgtcgtgaaaagcaacgtccagggtaatcatatc
tcagaccgaagcaacgatgacgactctgacggttctttgccgtgcactccacagatggcgtcagaatgtgggcctgaact
atcgaattgtccatcgggcgatgaagtattagaacatgatacaagacaactaattgaaaacttattgggggactatacag
gactgtctccgcctcgttggaagcaaagcaaggctcttacgacgatgacgcgagtggtgaaggatataattgcgaagcac
caatacgcatacaatggtatgatcgccaaacttgaactcgatgaccgaagcgacgacatgagtttcatcaattctgtggc
caagaccctgttcagtgatgggaccaccaactggggtcgcatcgccagcctggtggcatttggagcagtggtgagccagc
gcttgaaggagatgggcaggggacactgcattgagttggtgggccaaaatatcgccacatacctcctctctgaccaaagg
gactggctggtcaaaaacaatgcttggaatggatttgtagagttctttcatgtgcaagatccagagtcctcagtaaggaa
cgccctcatagcctttgctggatttgctgggcttggggcaacgctcgccatgttgatcaggaattcagcagattag
© 1998-2020Legal notice