Dataset for CDS BCL-2-like of organism Salmo trutta

[Download (right click)] [Edit] [Sequences] [Repertoires]

14 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A673Z4J6_BCL2L1-      ----------------------------------atgtcttaca------
A0A674C4N2_BCL2L1-      ----------------------------------atgtcttaca------
A0A674C337_BCL2L1-      atg-------------------------------atgacttaca------
A0A674C578_BCL2L1-      -------------------------------------atgtgta------
A0A674C578_BCL2L1-      att-------------------------------atgacttaca------
A0A674D165_MCL1-01      atgctgaggttccaaagcgggctgctagcattccccgagttcaa------
A0A674D1T7_MCL1-01      -------------------------------tcaccgaa-----------
A0A673VWA7_MCL1-01      atg-----------agtctgtcgaactcgattacacgagccaca------
A0A674ELG3_MCL1-03      atg-----------agtctg------tcgtttacacgagccaca------
A0A674ELG3_MCL1-01      atg-----------agtctg------tcgtttacacgagccaca------
A0A674ELG3_MCL1-02      atg-----------agtctg------tcgtttacacgagccaca------
A0A674B0E5_BCL2-01      ----------------------------------atggcaaacg------
A0A673Z0A3_BCL2-01      atg-------------------------------atggcgaacgataatc
A0A674B8T7_BCL2-01      atg-------------------------------atggcaaacgagaatc
                                                                          

A0A673Z4J6_BCL2L1-      ---gtaacagg---gaact-----------------ggtggtgtttttta
A0A674C4N2_BCL2L1-      ---gtaacagg---gaact-----------------ggtggtgtttttta
A0A674C337_BCL2L1-      ---acaacaga---gaact-----------------ggtggtgtactata
A0A674C578_BCL2L1-      ---ttaacctatctgaact-----------------ggtggtatactata
A0A674C578_BCL2L1-      ---acaacaga---gaact-----------------ggtggtatactata
A0A674D165_MCL1-01      ---gttgta--ctcgaatgttgggtacgttacaatcgcaggtacaaaaca
A0A674D1T7_MCL1-01      --------------------------------------------------
A0A673VWA7_MCL1-01      ---actacgatgttgcattttcaaaat---------ggaggatcttcgta
A0A674ELG3_MCL1-03      ---actacgattttgaattttcaaaatggagtcgtcggaggctcttcgta
A0A674ELG3_MCL1-01      ---actacgattttgaattttcaaaatggagtcgtcggaggctcttcgta
A0A674ELG3_MCL1-02      ---actacgattttgaattttcaaaatggagtcgtcggaggctcttcgta
A0A674B0E5_BCL2-01      ---acgacaaccgctttat-----------------agtggaaaagtaca
A0A673Z0A3_BCL2-01      cttataacagtcgctttat-----------------tgttgaaaaataca
A0A674B8T7_BCL2-01      cttacaacagtcgctttat-----------------tgtcgaaaaataca
                                                                          

A0A673Z4J6_BCL2L1-      ta----------------agctatagactgtcccagaggaattattcatg
A0A674C4N2_BCL2L1-      ta----------------agctataaactgtcccagagaaattatccatg
A0A674C337_BCL2L1-      tt----------------acctataaactatcacagagggactacccctt
A0A674C578_BCL2L1-      tt----------------acctataaactatcacagagagactacccctt
A0A674C578_BCL2L1-      tt----------------acctataaactatcacagagagactacccctt
A0A674D165_MCL1-01      ttgcattatctgtgcatcgccaccaggccaagatcattacatcgcgtgcc
A0A674D1T7_MCL1-01      --------------------------------------------------
A0A673VWA7_MCL1-01      cctagctgatgatgctaggccgttgtactatttccacggggctggggcca
A0A674ELG3_MCL1-03      ccctgctgg------tacccctttgtgctatttcggcgagactg------
A0A674ELG3_MCL1-01      ccctgctgg------tacccctttgtgctatttcggcgagactg------
A0A674ELG3_MCL1-02      ccctgctgg------tacccctttgtgctatttcggcgagactg------
A0A674B0E5_BCL2-01      tt----------------tgtcacaaactcttgaaacgaggatatgcgt-
A0A673Z0A3_BCL2-01      tc----------------catcacaaactgttgaagaagggatttgtat-
A0A674B8T7_BCL2-01      tc----------------catcacaaactgttgaacatgggatttgtat-
                                                                          

A0A673Z4J6_BCL2L1-      ttgtcaattggggctggagggtgcaagtggacggactgagggagatgagg
A0A674C4N2_BCL2L1-      ttgtcagttggtgctggagggtgcaagtgggcggactgagggggatgaag
A0A674C337_BCL2L1-      caaccacatggagctcacggaagcccagaatcggactgaggggggacagg
A0A674C578_BCL2L1-      caaccacattgggctcacagaagctcccagtcggactgaggggggacagg
A0A674C578_BCL2L1-      caaccacattgggctcacagaagctcccagtcggactgaggggggacagg
A0A674D165_MCL1-01      ctgagattggtaacctcctcaaaa-----------caaagttgaagcatc
A0A674D1T7_MCL1-01      --------------------------------------------------
A0A673VWA7_MCL1-01      tatgtgctggggcgtcaccgaagt-----------ctaaagtggaca---
A0A674ELG3_MCL1-03      tatgtgctggggcgtcaccgaagt-----------caaaagtggatactg
A0A674ELG3_MCL1-01      tatgtgctggggcgtcaccgaagt-----------caaaagtggatactg
A0A674ELG3_MCL1-02      tatgtgctggggcgtcaccgaagt-----------caaaagtggatactg
A0A674B0E5_BCL2-01      --------gggatttcgaggatgccg---------aggaggaggaaggtg
A0A673Z0A3_BCL2-01      --------gggaatt---------ta---------atccagaaaacgatt
A0A674B8T7_BCL2-01      --------ggaaatt---------tc---------aagcagaaaacgatt
                                                                          

A0A673Z4J6_BCL2L1-      ccattgcaaatgggtctgtgg---------ggaacagcagaa--------
A0A674C4N2_BCL2L1-      ccattgcaaatgggtctttgggaaacaacaggaacggcagaa--------
A0A674C337_BCL2L1-      t----ggaagggggt---------gctgcagtcataacatac--------
A0A674C578_BCL2L1-      c----ggaagggggg---------gcggcagtcacgacacaccccaacgg
A0A674C578_BCL2L1-      c----ggaagggggg---------gcggcagtcacgacacaccccaacgg
A0A674D165_MCL1-01      tgaaactgtcagggtctatcgacagc--actcctttgttcactaggagag
A0A674D1T7_MCL1-01      --------------------------------------------------
A0A673VWA7_MCL1-01      ---tgggaaatgggactggcgatact--ccaccacgacccacgacgttag
A0A674ELG3_MCL1-03      acttgggtaatgggactggcgacacc--ccaccacgacccacgaagttag
A0A674ELG3_MCL1-01      acttgggtaatgggactggcgacacc--ccaccacgacccacgaagttag
A0A674ELG3_MCL1-02      acttgggtaatgggactggcgacacc--ccaccacgacccacgaagttag
A0A674B0E5_BCL2-01      ccgctaataatgg-gtcgatgatttc----tcctcggct-----------
A0A673Z0A3_BCL2-01      ccccaaataatggctttggggagccc----tctccccctaactcccctga
A0A674B8T7_BCL2-01      ctccaaataatggctttggggacccc----tctacacccaactcccccga
                                                                          

A0A673Z4J6_BCL2L1-      ----gcaacttggcaaag--------------------------------
A0A674C4N2_BCL2L1-      ----gcaatttgggtaag--------------------------------
A0A674C337_BCL2L1-      ----gtcaacgggacgagtcccgggac-----tccaccaccacggcagtc
A0A674C578_BCL2L1-      cgcagcgaacgggacgagtcctgggac-----t---ccaccgcgacagtc
A0A674C578_BCL2L1-      cgcagcgaacgggacgagtcctgggac-----t---ccaccgcgacagtc
A0A674D165_MCL1-01      gacccggacatgagtacagctggggag-----gcctcgaacccgatagcg
A0A674D1T7_MCL1-01      --------------------------------------------------
A0A673VWA7_MCL1-01      ga---------gtgaatgtcgtgaaaa-----gcaacggcctcgataatc
A0A674ELG3_MCL1-03      ga---------gtgaatgtcgtgaaaa-----gcaacgtccagggtaatc
A0A674ELG3_MCL1-01      ga---------gtgaatgtcgtgaaaa-----gcaacgtccagggtaatc
A0A674ELG3_MCL1-02      ga---------gtgaatgtcgtgaaaa-----gcaacgtccagggtaatc
A0A674B0E5_BCL2-01      gggtttggcacggcggtgccacggggccaataacgccggcccgggcagcg
A0A673Z0A3_BCL2-01      agtttttgcacggaggtccca---gccctccgctgaaggtgtggacactg
A0A674B8T7_BCL2-01      agtttttgcacggaggtccca---gcccaccgccgcgggcgaggacaccg
                                                                          

A0A673Z4J6_BCL2L1-      ----ccctca----------------------------------------
A0A674C4N2_BCL2L1-      ----ccttcc----------------------------------------
A0A674C337_BCL2L1-      acccccctcc----------------------------------------
A0A674C578_BCL2L1-      tcccccctcg----------------------------------------
A0A674C578_BCL2L1-      tcccccctcg----------------------------------------
A0A674D165_MCL1-01      ccttagctta-cgacaccacaaacttcggtgtactccttccacatacggt
A0A674D1T7_MCL1-01      --tcggctta-cggcgc---------------------------------
A0A673VWA7_MCL1-01      atttgtcagaccgaagcaacaa-------------------------tga
A0A674ELG3_MCL1-03      atatctcagaccgaagcaacga-------------------------tga
A0A674ELG3_MCL1-01      atatctcagaccgaagcaacga-------------------------tga
A0A674ELG3_MCL1-02      atatctcagaccgaagcaacga-------------------------tga
A0A674B0E5_BCL2-01      tccctagtctttccaaatggc-----------------------------
A0A673Z0A3_BCL2-01      aatctcagctcccaaacagga-----------------------------
A0A674B8T7_BCL2-01      accctccttaccaaaacagga-----------------------------
                                                                          

A0A673Z4J6_BCL2L1-      ---------------------------tctcc------------------
A0A674C4N2_BCL2L1-      ---------------------------tctcc------------------
A0A674C337_BCL2L1-      ---------------------------tcccc------------------
A0A674C578_BCL2L1-      ---------------------------tcccc------------------
A0A674C578_BCL2L1-      ---------------------------tcccc------------------
A0A674D165_MCL1-01      tgacacacacaaatgtttcatgtgtaacctcgaaatcaacaactttatat
A0A674D1T7_MCL1-01      ---------------------------cctcaccatc-------------
A0A673VWA7_MCL1-01      cgac---------tctttgccgtgcactccccagatg-------------
A0A674ELG3_MCL1-03      cgactctgacggttctttgccgtgcactccacagatg-------------
A0A674ELG3_MCL1-01      cgactctgacggttctttgccgtgcactccacagatg-------------
A0A674ELG3_MCL1-02      cgactctgacggttctttgccgtgcactccacagatg-------------
A0A674B0E5_BCL2-01      ---------------------------tctcccaacc-------------
A0A673Z0A3_BCL2-01      ---------------------------tcccgcaacc-------------
A0A674B8T7_BCL2-01      ---------------------------gtccgcaacc-------------
                                                                          

A0A673Z4J6_BCL2L1-      -acaggg------gggcatg------------------------------
A0A674C4N2_BCL2L1-      -acaggg------gggaatt------------------------------
A0A674C337_BCL2L1-      -tcggcggacagcgggtctg------------------------------
A0A674C578_BCL2L1-      -tcagcggacaatgggcctg------------------------------
A0A674C578_BCL2L1-      -tcagcggacaatgggcctg------------------------------
A0A674D165_MCL1-01      cacatcaggaaacataccatcaccag----------accgg-------ag
A0A674D1T7_MCL1-01      -----cagggaaggtacctaccc--------------tccg-------ag
A0A673VWA7_MCL1-01      -gcgtcagaatgtgggcctgaactatcgaattgtccatcgggcgatgaag
A0A674ELG3_MCL1-03      -gcgtcagaatgtgggcctgaactatcgaattgtccatcgggcgatgaag
A0A674ELG3_MCL1-01      -gcgtcagaatgtgggcctgaactatcgaattgtccatcgggcgatgaag
A0A674ELG3_MCL1-02      -gcgtcagaatgtgggcctgaactatcgaattgtccatcgggcgatgaag
A0A674B0E5_BCL2-01      -ggacccgcatgcagctattcac---------------------------
A0A673Z0A3_BCL2-01      -ggaccgacatgcccggctccat---------------------------
A0A674B8T7_BCL2-01      -tgacccacatgccaggctccac---------------------------
                                                                          

A0A673Z4J6_BCL2L1-      ---------------------gagccagtgaaa-----------------
A0A674C4N2_BCL2L1-      ---------------------gaggcagtgaaa-----------------
A0A674C337_BCL2L1-      ---------------------gatgcagtgaaa-----------------
A0A674C578_BCL2L1-      ---------------------gacgcagtgaaa-----------------
A0A674C578_BCL2L1-      ---------------------gacgcagtgaaa-----------------
A0A674D165_MCL1-01      ccctggacaccgacaccaggcaactcattaaatgtgtcctaggacaatgt
A0A674D1T7_MCL1-01      ----ggacatcaccc----gcaactcattaaat--------ggacaatgt
A0A673VWA7_MCL1-01      tattggaagatgataccagacaactcattgagaattttttgggggactac
A0A674ELG3_MCL1-03      tattagaacatgatacaagacaactaattgaaaacttattgggggactat
A0A674ELG3_MCL1-01      tattagaacatgatacaagacaactaattgaaaacttattgggggactat
A0A674ELG3_MCL1-02      tattagaacatgatacaagacaactaattgaaaacttattgggggactat
A0A674B0E5_BCL2-01      --------------------------------------------------
A0A673Z0A3_BCL2-01      --------------------------------------------------
A0A674B8T7_BCL2-01      --------------------------------------------------
                                                                          

A0A673Z4J6_BCL2L1-      -----------------------gcagcactacgggactcagtggatgag
A0A674C4N2_BCL2L1-      -----------------------gcagcactacgggactcagtggatgag
A0A674C337_BCL2L1-      -----------------------gaggcattgcgggactctgccaacgag
A0A674C578_BCL2L1-      -----------------------gaggcattgcgggactctgccaacgag
A0A674C578_BCL2L1-      -----------------------gaggcattgcgggactctgccaacgag
A0A674D165_MCL1-01      acgggacttctgaaacctaggtggaacgaaagcaaagctctgtcaacaa-
A0A674D1T7_MCL1-01      acgggacttctgaaacctaggtggaacgaaagcaaagctctgtcaacaa-
A0A673VWA7_MCL1-01      acaggactgtctcaccctcgatggaaacaaagcaagcctcttacgacga-
A0A674ELG3_MCL1-03      acaggactgtctccgcctcgttggaagcaaagcaaggctcttacgacga-
A0A674ELG3_MCL1-01      acaggactgtctccgcctcgttggaagcaaagcaaggctcttacgacga-
A0A674ELG3_MCL1-02      acaggactgtctccgcctcgttggaagcaaagcaaggctcttacgacga-
A0A674B0E5_BCL2-01      -----------------------agagttttgcgtgaggccggggacgaa
A0A673Z0A3_BCL2-01      -----------------------agggtgctgcgcgaggcgggggacgag
A0A674B8T7_BCL2-01      -----------------------agggtcctgcgcgaggcgggtggcgag
                                                        *      *        * 

A0A673Z4J6_BCL2L1-      tttgagctgcgct----------------------acacccgcgccttta
A0A674C4N2_BCL2L1-      tttgagctgcgtt----------------------acacccgcgccttca
A0A674C337_BCL2L1-      tttgagctgcgtt----------------------atgccagagcgttca
A0A674C578_BCL2L1-      tttgagctgcgtt----------------------atgccagagcgttca
A0A674C578_BCL2L1-      tttgagctgcgtt----------------------atgccagagcgttca
A0A674D165_MCL1-01      --tgagtagagttgttggtcaattactggagaagcacagatacacataca
A0A674D1T7_MCL1-01      --tgagtagagttgttggtcaattactggagaagcacagatacacatcca
A0A673VWA7_MCL1-01      --tgaagcgagtggtggaggacgtaatagcaaagcaccgatacgcataca
A0A674ELG3_MCL1-03      --tgacgcgagtggtgaaggatataattgcgaagcaccaatacgcataca
A0A674ELG3_MCL1-01      --tgacgcgagtggtgaaggatataattgcgaagcaccaatacgcataca
A0A674ELG3_MCL1-02      --tgacgcgagtggtgaaggatataattgcgaagcaccaatacgcataca
A0A674B0E5_BCL2-01      ctcgaaagactgt----------------------accagcccgacttcg
A0A673Z0A3_BCL2-01      attgaaataatgt----------------------atcagcgggactttg
A0A674B8T7_BCL2-01      attgaaagaatgt----------------------atcagcgggactttg
                           **                              *          *   

A0A673Z4J6_BCL2L1-      gtgacctctcctcccagctccac----atcacccctgccacagcctacca
A0A674C4N2_BCL2L1-      gtgacctctcctcccagctccac----atcacccctgccacagcctacca
A0A674C337_BCL2L1-      gtgacctgtcctcccagctacac----atcacgccgtccacagcctacca
A0A674C578_BCL2L1-      gtgacctgtcctcccagctgcac----atcacgccggccacagcctacca
A0A674C578_BCL2L1-      gtgacctgtcctcccagctgcac----atcacgccggccacagcctacca
A0A674D165_MCL1-01      atggtatgatcaacacactctatgtggatgacagaggggatgacgt----
A0A674D1T7_MCL1-01      atggtatgatcaacacactctatgtggatgacagaggggatgacgt----
A0A673VWA7_MCL1-01      atggtatggtcgccaaacttgacttggatgaccgatgcgatgacat----
A0A674ELG3_MCL1-03      atggtatgatcgccaaacttgaactcgatgaccgaagcgacgacat----
A0A674ELG3_MCL1-01      atggtatgatcgccaaacttgaactcgatgaccgaagcgacgacat----
A0A674ELG3_MCL1-02      atggtatgatcgccaaacttgaactcgatgaccgaagcgacgacat----
A0A674B0E5_BCL2-01      cagagatgtcacaccagctgtat----ctcacatcctccacggctgagag
A0A673Z0A3_BCL2-01      cagagatgtcggggcagttgcat----tttacgcccagtacagcacagag
A0A674B8T7_BCL2-01      cagagatgtcggggcagttgcat----tttacacccagcacggcacagag
                          *   *           *  *      * **       *   *      

A0A673Z4J6_BCL2L1-      cagctttgagagtgtgatggacgaag---tgttcagggacggg---gtca
A0A674C4N2_BCL2L1-      cagctttgagagcgtgatggacgaag---tgttcagggatggg---gtca
A0A674C337_BCL2L1-      gagctttgagaacgtgatggacgagg---tgttccgggacggt---gtca
A0A674C578_BCL2L1-      gagcttcgagaacgtgatggatgagg---ttttccgtgacggt---gtga
A0A674C578_BCL2L1-      gagcttcgagaacgtgatggatgagg---ttttccgtgacggt---gtga
A0A674D165_MCL1-01      gaagttcctcagtgcagtagcccatatcatctttcaagacgggaccgtca
A0A674D1T7_MCL1-01      gaagttcctcagtgcagtaacccatatcatctttcaagacgggaccgtca
A0A673VWA7_MCL1-01      gggcgtcatcaattctgtggccaagaccatgttcagtgatgggatcacaa
A0A674ELG3_MCL1-03      gagtttcatcaattctgtggccaagaccctgttcagtgatgggaccacca
A0A674ELG3_MCL1-01      gagtttcatcaattctgtggccaagaccctgttcagtgatgggaccacca
A0A674ELG3_MCL1-02      gagtttcatcaattctgtggccaagaccctgttcagtgatgggaccacca
A0A674B0E5_BCL2-01      gagatttagagaggtgatagacgagc---tgttcagggatggg---gtta
A0A673Z0A3_BCL2-01      aaggtttactgctgtaatagaggagc---tcttccgcgacggt---gtaa
A0A674B8T7_BCL2-01      aaggtttaccgctgtaatagatgagc---tcttcagcgacggg---gtaa
                             *           *     *     * **    ** **       *

A0A673Z4J6_BCL2L1-      actggggtcgcgtggtgggtctgtttgctttcggcggggccttgtgtgtt
A0A674C4N2_BCL2L1-      actggggtcgcgtggtgggcctgtttgctttcggcggggccctgtgcgtt
A0A674C337_BCL2L1-      actggggacgggtggtgggcctgttttccttcggaggggccctctgtgta
A0A674C578_BCL2L1-      actggggacgtgtggtgggcctgtttgccttcggaggggccctctgtgta
A0A674C578_BCL2L1-      actggggacgtgtggtgggcctgtttgccttcggaggggccctctgtgta
A0A674D165_MCL1-01      actggggccgtgttgccagcctgacatcttttggagctgcggtgtgccag
A0A674D1T7_MCL1-01      actggggccgtgttgccagcctgacatcttttggagctgcggtgtgccag
A0A673VWA7_MCL1-01      actggggtcgcatcgccagcctggtggcatttggagcagtggtgagccag
A0A674ELG3_MCL1-03      actggggtcgcatcgccagcctggtggcatttggagcagtggtgagccag
A0A674ELG3_MCL1-01      actggggtcgcatcgccagcctggtggcatttggagcagtggtgagccag
A0A674ELG3_MCL1-02      actggggtcgcatcgccagcctggtggcatttggagcagtggtgagccag
A0A674B0E5_BCL2-01      actggggacggattatcgccttcttcgagttcgggggcacaatatgcgtg
A0A673Z0A3_BCL2-01      actggggtcggattgtggctttctttgagtttggagggacaatgtgcgtg
A0A674B8T7_BCL2-01      actggggtcggattgtggctttctttgagtttggagggacaatgtgcgtg
                        ******* **  *        *       ** ** *      *  *    

A0A673Z4J6_BCL2L1-      gagtgtgttgagaaggatatgagcccactggtggcgcgcatcgcagactg
A0A674C4N2_BCL2L1-      gagtgtgttgagaaggatatgagccacctggtgatgcgcatcgcagactg
A0A674C337_BCL2L1-      gaatgtgtggacaaggagatgaaccccttggtgggaaggatcacagactg
A0A674C578_BCL2L1-      gagtgtgtggagaaagagatgagcccactagtgggacggattgcagactg
A0A674C578_BCL2L1-      gagtgtgtggagaaagagatgagcccactagtgggacggattgcagactg
A0A674D165_MCL1-01      tacttgaaagacaaggggagagacaactgtgtggaggtggcgggagagga
A0A674D1T7_MCL1-01      tacttgaaagacaaggggagagacaactgtgtggaggtggcgggagagga
A0A673VWA7_MCL1-01      cacctgaaggagaggggcaggggacactgcgttgagttggtgggccaaga
A0A674ELG3_MCL1-03      cgcttgaaggagatgggcaggggacactgcattgagttggtgggccaaaa
A0A674ELG3_MCL1-01      cgcttgaaggagatgggcaggggacactgcattgagttggtgggccaaaa
A0A674ELG3_MCL1-02      cgcttgaaggagatgggcaggggacactgcattgagttggtgggccaaaa
A0A674B0E5_BCL2-01      gaatgcgtgaacaaggagatgacgtcgcaggtggatcacatcgcggtgtg
A0A673Z0A3_BCL2-01      gagagcgtcaaccgggagatgacgacccaggtagacaacattgcccattg
A0A674B8T7_BCL2-01      gagagcgtcaaccgggagatgacgtcccaggtagacaacatcgctcgttg
                                  *    *  *            *                  

A0A673Z4J6_BCL2L1-      gatgaccacctacctggacaaccatatccagccctggatccagagccaag
A0A674C4N2_BCL2L1-      gatggccacctacctggacaatcatatccagccctggatccagagccaag
A0A674C337_BCL2L1-      gatgaccgtctacctggacaaccacatccagccctggatccagagccaag
A0A674C578_BCL2L1-      gatgactgtctacctggacaaccacatccagccctggatccagagccaag
A0A674C578_BCL2L1-      gatgactgtctacctggacaaccacatccagccctggatccagagccaag
A0A674D165_MCL1-01      gatatcagcgtacctggtcacacaccacaaggactggct----agtcaaa
A0A674D1T7_MCL1-01      gatatcagcatacctggtcactcaccacaaggactggct----agtcaaa
A0A673VWA7_MCL1-01      gattgccaaatatctcctctctgaccaaagtgactggct----gatcaaa
A0A674ELG3_MCL1-03      tatcgccacatacctcctctctgaccaaagggactggct----ggtcaaa
A0A674ELG3_MCL1-01      tatcgccacatacctcctctctgaccaaagggactggct----ggtcaaa
A0A674ELG3_MCL1-02      tatcgccacatacctcctctctgaccaaagggactggct----ggtcaaa
A0A674B0E5_BCL2-01      gatgacagagtatctaaatggaccactgctcagctggattcagg----ag
A0A673Z0A3_BCL2-01      gatgacagagtacctgaacggacccctgcagaactggatccagg----ag
A0A674B8T7_BCL2-01      gatgatggagtacttgaacggacccctacagaactggatccagg----ag
                         **       **  *                  **** *         * 

A0A673Z4J6_BCL2L1-      gagga----tgggaccgttttgcagagatctttggcagagatgctgctgc
A0A674C4N2_BCL2L1-      gagga----tgggaccgttttgcggagatcttcggcagagatgcagctgc
A0A674C337_BCL2L1-      gagga----tgggaccggtttgcagagatctttgggatggacgctgcagc
A0A674C578_BCL2L1-      gagga----tgggaccggtttgcagaaatctttgggaaggacgctgcagc
A0A674C578_BCL2L1-      gagga----tgggaccggtttgcagaaatctttgggaaggacgctgcagc
A0A674D165_MCL1-01      cataactcctggaatgggttcgtggagttctttccagtagc---------
A0A674D1T7_MCL1-01      cataactcctggaatgggttcgtggagttctatccagtagc---------
A0A673VWA7_MCL1-01      aacaatgcttggaatggatttgtagagttctttcatgtaca---------
A0A674ELG3_MCL1-03      aacaatgcttggaatggatttgtagagttctttcatgtgca---------
A0A674ELG3_MCL1-01      aacaatgcttggaatggatttgtagagttctttcatgtgca---------
A0A674ELG3_MCL1-02      aacaatgcttggaatggatttgtagagttctttcatgtgca---------
A0A674B0E5_BCL2-01      aacgggggatgggaggcctttgttgagctctatgacagaca--------g
A0A673Z0A3_BCL2-01      aatggtgactgggacgcctttgtggagatctatgggcagca--------g
A0A674B8T7_BCL2-01      aatggtggctgggacgcctttgtggagatctatgagcagca--------g
                         *       *** *    ** *  **  ***                   

A0A673Z4J6_BCL2L1-      agacgttcgacggtctcaggagagcataattaaatggctgctagctgggg
A0A674C4N2_BCL2L1-      agacgtccgacggtcccaggagagcttaagaaaatggctgctagttgggg
A0A674C337_BCL2L1-      cgagagcaggaagtctcaggagagctttaagaagtggcttctggcaggga
A0A674C578_BCL2L1-      tgagagcaggaagtcgcaggagagctttaagaagtggttgctggcgggga
A0A674C578_BCL2L1-      tgagagcaggaagtcgcaggagagctttaagaagtggttgctggcgggga
A0A674D165_MCL1-01      --agaaccggagtccagatctaggaacattattatgacccct-gttggat
A0A674D1T7_MCL1-01      --agaaccggagtccagatctaggaacattattattaccctt-gttggat
A0A673VWA7_MCL1-01      --agatcctgagtcctcagtaaggaacaccctcctagccatt-gctggag
A0A674ELG3_MCL1-03      --agatccagagtcctcagtaaggaacgccctcatagccttt-gctggat
A0A674ELG3_MCL1-01      --agatccagagtcctcagtaaggaacgccctcatagccttt-gctggat
A0A674ELG3_MCL1-02      --agatccagagtcctcagtaaggaacgccctcatagccttt-gctggat
A0A674B0E5_BCL2-01      agggactctgtgttctgttcgtggccgtccatcaagaccgtc-ttcggcc
A0A673Z0A3_BCL2-01      aggatctctgtcttccactcctggccctacctaaagacagtg-ttcggcc
A0A674B8T7_BCL2-01      aggatctct------cactcctggccgtacctaaagacagtg-ttcggcc
                                               *                      **  

A0A673Z4J6_BCL2L1-      tgattctgctttcaggagtg------ctggtcggcactctcatcatgaag
A0A674C4N2_BCL2L1-      tgatgctgctttcaggagta------ctggtcggcactctcatcatgaag
A0A674C337_BCL2L1-      tgaccctggtcacaggagtt------gtcgttgggtcaatcttcgctcag
A0A674C578_BCL2L1-      tgacgctggttaccggagtc------atcgtagggtcactcattgctcag
A0A674C578_BCL2L1-      tgacgctggttaccggagtc------atcgtagggtcactcattgctcag
A0A674D165_MCL1-01      tggctggtattggagcagca------atgaccttgttggttat-------
A0A674D1T7_MCL1-01      tggctggtattggagcagca------atgaccttgttggttat-------
A0A673VWA7_MCL1-01      ttgctgggattggggcaaca------ctcgccatgttcatcag-------
A0A674ELG3_MCL1-03      ttgctgggcttggggcaacg------ctcgccatgttgatcag-------
A0A674ELG3_MCL1-01      ttgctgggcttggggcaacg------ctcgccatgttgatcag-------
A0A674ELG3_MCL1-02      ttgctgggcttggggcaacg------ctcgccatgttgatcag-------
A0A674B0E5_BCL2-01      tggctgcactgggggccgcaagccttaccatcggagcataccttacacag
A0A673Z0A3_BCL2-01      tggccgccctgggtgcagccggagtcaccattggagcgttgttcatccag
A0A674B8T7_BCL2-01      tggccgccctgggagccgctggagtcaccatcggagccttgttcacccag
                        *        *    *                                   

A0A673Z4J6_BCL2L1-      aaacgtcagtga--------------------------------------
A0A674C4N2_BCL2L1-      aaatgccagtga--------------------------------------
A0A674C337_BCL2L1-      aaacgcctgtga--------------------------------------
A0A674C578_BCL2L1-      aaacgcctgtga--------------------------------------
A0A674C578_BCL2L1-      aaacgcctgtga--------------------------------------
A0A674D165_MCL1-01      --------gtga--------------------------------------
A0A674D1T7_MCL1-01      --------gtga--------------------------------------
A0A673VWA7_MCL1-01      --------gtga--------------------------------------
A0A674ELG3_MCL1-03      --------gaattcagcagattag--------------------------
A0A674ELG3_MCL1-01      --------acagttccctgctcaaccccaggggtgtgtggtgtgtttgtg
A0A674ELG3_MCL1-02      --------aaa---------ttaa--------------------------
A0A674B0E5_BCL2-01      aa------gtga--------------------------------------
A0A673Z0A3_BCL2-01      aa------gtga--------------------------------------
A0A674B8T7_BCL2-01      aa------gtga--------------------------------------
                                                                          

A0A673Z4J6_BCL2L1-      -
A0A674C4N2_BCL2L1-      -
A0A674C337_BCL2L1-      -
A0A674C578_BCL2L1-      -
A0A674C578_BCL2L1-      -
A0A674D165_MCL1-01      -
A0A674D1T7_MCL1-01      -
A0A673VWA7_MCL1-01      -
A0A674ELG3_MCL1-03      -
A0A674ELG3_MCL1-01      a
A0A674ELG3_MCL1-02      -
A0A674B0E5_BCL2-01      -
A0A673Z0A3_BCL2-01      -
A0A674B8T7_BCL2-01      -
                         

© 1998-2020Legal notice