Dataset for CDS BCL-2-like of organism Esox lucius

[Download (right click)] [Edit] [Sequences] [Repertoires]

9 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3P9AAB2_BCL2-01      ------------------------atg-----------------------
A0A3P8Y1W8_MCL1-01      ctctcttattcctacagacagaacatgt----caaaaagcgacccacg-g
A0A3P8Y1W8_MCL1-02      --------cttgca-------gacatgt----caaaaagcgacccacg-g
A0A3P8Y1W8_MCL1-03      gaggcgtgtttgt---------acatgt----caaaaagcgacccacg-g
A0A3P8Y1W8_MCL1-04      ------------------------atgaacctgtcgaaatcgcttacacg
A0A3P8Y1W8_MCL1-05      ------------------------atgaacctgtcgaaatcgcttacacg
A0A3P8XYL5_BCL2L1-      ---------------------attatga--------------cttaca--
A0A3P8XFS0_BCL2L1-      ------------------------atgt--------------cttaca--
A0A3P8XFS0_BCL2L1-      ------------------------atgt--------------cttaca--
                                                ***                       

A0A3P9AAB2_BCL2-01      ------------------------gcaaacgagaat-----------cca
A0A3P8Y1W8_MCL1-01      gacatcgacgaggatgccatcctcaaagggatgagcgctgaggagttaga
A0A3P8Y1W8_MCL1-02      gacatcgacgaggatgccatcctcaaagggatgagcgctgaggagttaga
A0A3P8Y1W8_MCL1-03      gacatcgacgaggatgccatcctcaaagggatgagcgctgaggagttaga
A0A3P8Y1W8_MCL1-04      agccacaactacgatgctcaacgttcaaaatggagt-cgtgggatctttg
A0A3P8Y1W8_MCL1-05      agccacaactacgatgctcaacgttcaaaatggagt-cgtgggatctttg
A0A3P8XYL5_BCL2L1-      ------------------------acaacaaagaac-tggtggcatacta
A0A3P8XFS0_BCL2L1-      ------------------------gtaatagggaac-tggtggtgttttt
A0A3P8XFS0_BCL2L1-      ------------------------gtaatagggaac-tggtggtgttttt
                                                  *     **                

A0A3P9AAB2_BCL2-01      tatg-------acagtcgcgtcattgtcga-aaattacatctatgataaa
A0A3P8Y1W8_MCL1-01      tgcgctggag----tatgagctgcaagagatggac---ccagagaatgcc
A0A3P8Y1W8_MCL1-02      tgcgctggag----tatgagctgcaagagatggac---ccagagaatgcc
A0A3P8Y1W8_MCL1-03      tgcgctggag----tatgagctgcaagagatggac---ccagagaatgcc
A0A3P8Y1W8_MCL1-04      tattctggtgcccctttgtgctattttagcccgacagggccc-ttatgtc
A0A3P8Y1W8_MCL1-05      tattctggtgcccctttgtgctattttagcccgacagggccc-ttatgtc
A0A3P8XYL5_BCL2L1-      tatt-------acctataaactatcccagagaaactaccccatcaatcac
A0A3P8XFS0_BCL2L1-      tata-------aactataaactgtcccagaggaattattcctgttgtgaa
A0A3P8XFS0_BCL2L1-      tata-------aactataaactgtcccagaggaattattcctgttgtgaa
                        *                           *    *            *   

A0A3P9AAB2_BCL2-01      ctg--------ttgaaga-----atggatttgtttg--------------
A0A3P8Y1W8_MCL1-01      atgctgc----ctgcagggttccgccagcgtgatca--gaccaagaagag
A0A3P8Y1W8_MCL1-02      atgctgc----ctgcagggttccgccagcgtgatca--gaccaagaagag
A0A3P8Y1W8_MCL1-03      atgctgc----ctgcagggttccgccagcgtgatca--gaccaagaagag
A0A3P8Y1W8_MCL1-04      ctgcggcctcttcgaagt------ccaaaatggacgttgatttagg----
A0A3P8Y1W8_MCL1-05      ctgcggcctcttcgaagt------ccaaaatggacgttgatttagg----
A0A3P8XYL5_BCL2L1-      actgggc----tcacagg------agcatttgatcg--gactgagggggg
A0A3P8XFS0_BCL2L1-      ttggagc----tggaggg------tgcaagtggacg--gactgaggg---
A0A3P8XFS0_BCL2L1-      ttggagc----tggaggg------tgcaagtggacg--gactgaggg---
                                        *             **                  

A0A3P9AAB2_BCL2-01      ----------ggaatttcaaac----------------------------
A0A3P8Y1W8_MCL1-01      cccg--acaggggttttcgaccgtga-----cgccctgctggatc--act
A0A3P8Y1W8_MCL1-02      cccg--acaggggttttcgaccgtga-----cgccctgctggatc--act
A0A3P8Y1W8_MCL1-03      cccg--acaggggttttcgaccgtga-----cgccctgctggatc--act
A0A3P8Y1W8_MCL1-04      ------aaatgggactgctgatactcctgtccgacctacgaagttagaag
A0A3P8Y1W8_MCL1-05      ------aaatgggactgctgatactcctgtccgacctacgaagttagaag
A0A3P8XYL5_BCL2L1-      agaggtggaagaggtggcagcagtcaccatgcaccccaatggcac---aa
A0A3P8XFS0_BCL2L1-      ------agaagaggctactgca---------------aatgggtc---tg
A0A3P8XFS0_BCL2L1-      ------agaagaggctactgca---------------aatgggtc---tg
                                  *      *                                

A0A3P9AAB2_BCL2-01      ---agagaaccaatctcg-------aaata--------------------
A0A3P8Y1W8_MCL1-01      tggagaaaactgctctagagcatgcggacag------agaagacctagtg
A0A3P8Y1W8_MCL1-02      tggagaaaactgctctagagcatgcggacag------agaagacctagtg
A0A3P8Y1W8_MCL1-03      tggagaaaactgctctagagcatgcggacag------agaagacctagtg
A0A3P8Y1W8_MCL1-04      taaatatgacgaaacccaacgtattggatagtcgtttgtcagacctggcc
A0A3P8Y1W8_MCL1-05      taaatatgacgaaacccaacgtattggatagtcgtttgtcagacctggcc
A0A3P8XYL5_BCL2L1-      tgaatgggacgagtcctg-------ggactc--------ca-ac------
A0A3P8XFS0_BCL2L1-      tgg--ggaacgg---cag-------gaacag--------cagac------
A0A3P8XFS0_BCL2L1-      tgg--ggaacgg---cag-------gaacag--------cagac------
                                **                 *                      

A0A3P9AAB2_BCL2-01      -acgtctttgaggatcc---------------------------------
A0A3P8Y1W8_MCL1-01      cccttcactggagagaagaaagggagagcgtttgttcctaaggagggcca
A0A3P8Y1W8_MCL1-02      cccttcactggagagaagaaagggagagcgtttgttcctaaggagggcca
A0A3P8Y1W8_MCL1-03      cccttcactggagagaagaaagggagagcgtttgttcctaaggagggcca
A0A3P8Y1W8_MCL1-04      gacgactccgacgactc---------------------------------
A0A3P8Y1W8_MCL1-05      gacgactccgacgactc---------------------------------
A0A3P8XYL5_BCL2L1-      -acaac-------agtc---------------------------------
A0A3P8XFS0_BCL2L1-      -gcaatttgggaaag-----------------------------------
A0A3P8XFS0_BCL2L1-      -gcaatttgggaaag-----------------------------------
                          *          *                                    

A0A3P9AAB2_BCL2-01      ------ctctcccccca--------actcccccgaa--ctttttgcacgg
A0A3P8Y1W8_MCL1-01      cgggcagatccccatcaatgagcagatcaccctggagcctgagcttgagg
A0A3P8Y1W8_MCL1-02      cgggcagatccccatcaatgagcagatcaccctggagcctgagcttgagg
A0A3P8Y1W8_MCL1-03      cgggcagatccccatcaatgagcagatcaccctggagcctgagcttgagg
A0A3P8Y1W8_MCL1-04      -------attgccgtgc--------actcccctgatggtta-----ctga
A0A3P8Y1W8_MCL1-05      -------attgccgtgc--------actcccctgatggtta-----ctga
A0A3P8XYL5_BCL2L1-      -------ccccccctca--------tctcctcggcggactgttggcctgg
A0A3P8XFS0_BCL2L1-      -----------ccctca--------actccacagggg------tgcatgg
A0A3P8XFS0_BCL2L1-      -----------ccctca--------actccacagggg------tgcatgg
                                   **                * * *              * 

A0A3P9AAB2_BCL2-01      aggc--tccaacctcccgccgct--------ggcgaggacaacgaccctc
A0A3P8Y1W8_MCL1-01      aggccctgaagaatgctacagatgctgagatgtgtgacatagcagccatc
A0A3P8Y1W8_MCL1-02      aggccctgaagaatgctacagatgctgagatgtgtgacatagcagccatc
A0A3P8Y1W8_MCL1-03      aggccctgaagaatgctacagatgctgagatgtgtgacatagcagccatc
A0A3P8Y1W8_MCL1-04      gtgtagtgcgg--------------------ggttatcacattgcccatc
A0A3P8Y1W8_MCL1-05      gtgtagtgcgg--------------------ggttatcacattgcccatc
A0A3P8XYL5_BCL2L1-      atgcagtgaaa--------------------g--aggcactgcgggactc
A0A3P8XFS0_BCL2L1-      aggcagtgaaa--------------------g--cagcactacgggactc
A0A3P8XFS0_BCL2L1-      aggcagtgaaa--------------------g--cagcactacgggactc
                          *   *                        *      *         **

A0A3P9AAB2_BCL2-01      ----------------agttcgcaaataggatcccgcaaccggacccgc-
A0A3P8Y1W8_MCL1-01      ctgggaatgtacacactgatgagcaacaag---cagta-------ctacg
A0A3P8Y1W8_MCL1-02      ctgggaatgtacacactgatgagcaacaag---cagta-------ctacg
A0A3P8Y1W8_MCL1-03      ctgggaatgtacacactgatgagcaacaag---cagta-------ctacg
A0A3P8Y1W8_MCL1-04      --------------------gggcaatgaggttttgga-------caacg
A0A3P8Y1W8_MCL1-05      --------------------gggcaatgaggttttgga-------caacg
A0A3P8XYL5_BCL2L1-      --------------------tgccaacgag--tttgag-------ctgcg
A0A3P8XFS0_BCL2L1-      --------------------tgcagatgag--tttgag-------ctgcg
A0A3P8XFS0_BCL2L1-      --------------------tgcagatgag--tttgag-------ctgcg
                                                 *   *     *         *  * 

A0A3P9AAB2_BCL2-01      --acgcccggctccacagagtcctccgcgatgccgggaacgagatcgaaa
A0A3P8Y1W8_MCL1-01      --acgccctgggcaccactggtaccatcgccaacacagagggcatcaaca
A0A3P8Y1W8_MCL1-02      --acgccctgggcaccactggtaccatcgccaacacagagggcatcaaca
A0A3P8Y1W8_MCL1-03      --acgccctgggcaccactggtaccatcgccaacacagagggcatcaaca
A0A3P8Y1W8_MCL1-04      --ataccagacaactcattgaga---------------------------
A0A3P8Y1W8_MCL1-05      --ataccagacaactcattgaga---------------------------
A0A3P8XYL5_BCL2L1-      ttacgccctagcattcagtgacc---------------------------
A0A3P8XFS0_BCL2L1-      ctacacccgtgccttcagtgatc---------------------------
A0A3P8XFS0_BCL2L1-      ctacacccgtgccttcagtgatc---------------------------
                          *  **        **  *                              

A0A3P9AAB2_BCL2-01      gaatgtatcagcgggactttgcagagatgtcggggcagttgcatattacg
A0A3P8Y1W8_MCL1-01      gcgtcgtaaaaccagatccattcaag--atcttcccagacgagccgccca
A0A3P8Y1W8_MCL1-02      gcgtcgtaaaaccagatccattcaag--atcttcccagacgagccgccca
A0A3P8Y1W8_MCL1-03      gcgtcgtaaaaccagatccattcaag--atcttcccagacgagccgccca
A0A3P8Y1W8_MCL1-04      ---------------atttattaagg--gactacacaggactgtctcaac
A0A3P8Y1W8_MCL1-05      ---------------atttattaagg--gactacacaggactgtctcaac
A0A3P8XYL5_BCL2L1-      ---------------tgtcat------------cccagctgcacctcaca
A0A3P8XFS0_BCL2L1-      ---------------tctcct------------cccagctccacatcacc
A0A3P8XFS0_BCL2L1-      ---------------tctcct------------cccagctccacatcacc
                                                           ***            

A0A3P9AAB2_BCL2-01      cccagc--------------------------------------------
A0A3P8Y1W8_MCL1-01      accctacgaatgtggaggagacccttcagcagatccagactaatgaca--
A0A3P8Y1W8_MCL1-02      accctacgaatgtggaggagacccttcagcagatccagactaatgaca--
A0A3P8Y1W8_MCL1-03      accctacgaatgtggaggagacccttcagcagatccagactaatgaca--
A0A3P8Y1W8_MCL1-04      ctcgttggaaacaaaacaagtctcttgtgacgatgaaaagagtggtgggc
A0A3P8Y1W8_MCL1-05      ctcgttggaaacaaaacaagtctcttgtgacgatgaaaagagtggtgggc
A0A3P8XYL5_BCL2L1-      ccggct--------------------------------------------
A0A3P8XFS0_BCL2L1-      cccgcc--------------------------------------------
A0A3P8XFS0_BCL2L1-      cccgcc--------------------------------------------
                                                                          

A0A3P9AAB2_BCL2-01      ------acggcacatgga----------------------------cgat
A0A3P8Y1W8_MCL1-01      ------gcagcctgcttgaagtgaacctcaat--------------aaca
A0A3P8Y1W8_MCL1-02      ------gcagcctgcttgaagtgaacctcaat--------------aaca
A0A3P8Y1W8_MCL1-03      ------gcagcctgcttgaagtgaacctcaat--------------aaca
A0A3P8Y1W8_MCL1-04      gacgtaatagccaagcacacatacgcatacaagggtatgatctccaaact
A0A3P8Y1W8_MCL1-05      gacgtaatagccaagcacacatacgcatacaagggtatgatctccaaact
A0A3P8XYL5_BCL2L1-      ------acagcctaccag----------------------------agct
A0A3P8XFS0_BCL2L1-      ------acagcctaccac----------------------------agtt
A0A3P8XFS0_BCL2L1-      ------acagcctaccac----------------------------agtt
                                 **                                       

A0A3P9AAB2_BCL2-01      ttaccgcagt------------aatagacgaac-----------------
A0A3P8Y1W8_MCL1-01      ttaaggacattcccatcccaacgctgaaagaga-----------------
A0A3P8Y1W8_MCL1-02      ttaaggacattcccatcccaacgctgaaagaga-----------------
A0A3P8Y1W8_MCL1-03      ttaaggacattcccatcccaacgctgaaagaga-----------------
A0A3P8Y1W8_MCL1-04      ttgcttggat------------gatcaaggggatgacatgggtttcatca
A0A3P8Y1W8_MCL1-05      ttgcttggat------------gatcaaggggatgacatgggtttcatca
A0A3P8XYL5_BCL2L1-      ttgcaagtgt------------gatggatgagg-----------------
A0A3P8XFS0_BCL2L1-      ttgaaagtgt------------gatggacgagg-----------------
A0A3P8XFS0_BCL2L1-      ttgaaagtgt------------gatggacgagg-----------------
                        **       *              *  * *                    

A0A3P9AAB2_BCL2-01      ------------------tgttcagcgacggtgta---aac-------tg
A0A3P8Y1W8_MCL1-01      ------------------tctttgaggcaatgaagaccaacactcacgtg
A0A3P8Y1W8_MCL1-02      ------------------tctttgaggcaatgaagaccaacactcacgtg
A0A3P8Y1W8_MCL1-03      ------------------tctttgaggcaatgaagaccaacactcacgtg
A0A3P8Y1W8_MCL1-04      cgtctgtggccaagagtctgttcagtgatgggactacaaac-------tg
A0A3P8Y1W8_MCL1-05      cgtctgtggccaagagtctgttcagtgatgggactacaaac-------tg
A0A3P8XYL5_BCL2L1-      ------------------tgttccgggatggggtg---aac-------tg
A0A3P8XFS0_BCL2L1-      ------------------tgttcagggatggggtt---aac-------tg
A0A3P8XFS0_BCL2L1-      ------------------tgttcagggatggggtt---aac-------tg
                                          * **    *           ***       **

A0A3P9AAB2_BCL2-01      gggtc-----ggattgtg---------------gctttccttgagttt--
A0A3P8Y1W8_MCL1-01      gagtctctgagcatcgccgccacccgtagcaatgaccctgtggcctttgc
A0A3P8Y1W8_MCL1-02      gagtctctgagcatcgccgccacccgtagcaatgaccctgtggcctttgc
A0A3P8Y1W8_MCL1-03      gagtctctgagcatcgccgccacccgtagcaatgaccctgtggcctttgc
A0A3P8Y1W8_MCL1-04      gggtc-----gcattgcc---------------agcttggtgggcttt--
A0A3P8Y1W8_MCL1-05      gggtc-----gcattgcc---------------agcttggtgggcttt--
A0A3P8XYL5_BCL2L1-      gggaa-----gggttgtg---------------ggcctgtttgcgttc--
A0A3P8XFS0_BCL2L1-      gggtc-----gtgtggtg---------------ggcctgtttgctttc--
A0A3P8XFS0_BCL2L1-      gggtc-----gtgtggtg---------------ggcctgtttgctttc--
                        * *       *  * *                        * *  **   

A0A3P9AAB2_BCL2-01      ------------------ggagggacaatgtgcgtggaga----gcgtca
A0A3P8Y1W8_MCL1-01      tgttgctgagatgctccaggagaacaccactctgcagagtcttaacatcg
A0A3P8Y1W8_MCL1-02      tgttgctgagatgctccaggagaacaccactctgcagagtcttaacatcg
A0A3P8Y1W8_MCL1-03      tgttgctgagatgctccaggagaacaccactctgcagagtcttaacatcg
A0A3P8Y1W8_MCL1-04      ------------------ggggcagt-----------agt----gagtca
A0A3P8Y1W8_MCL1-05      ------------------ggggcagt-----------agt----gagtca
A0A3P8XYL5_BCL2L1-      ------------------ggaggggccctctgtgtagagt----gcgtgg
A0A3P8XFS0_BCL2L1-      ------------------ggcggggccctatgtgttgagt----gtgttg
A0A3P8XFS0_BCL2L1-      ------------------ggcggggccctatgtgttgagt----gtgttg
                                          ** *               **        *  

A0A3P9AAB2_BCL2-01      a-----ccgggagatgacg------ccccaggtgaacaacatcgtccatt
A0A3P8Y1W8_MCL1-01      a-----gtcgaacttcatcaccagtgagggcatgacggccattgtcaagg
A0A3P8Y1W8_MCL1-02      a-----gtcgaacttcatcaccagtgagggcatgacggccattgtcaagg
A0A3P8Y1W8_MCL1-03      a-----gtcgaacttcatcaccagtgagggcatgacggccattgtcaagg
A0A3P8Y1W8_MCL1-04      acacctgaaggagatgggcaagggaaactgcgttgagttggttggccaag
A0A3P8Y1W8_MCL1-05      acacctgaaggagatgggcaagggaaactgcgttgagttggttggccaag
A0A3P8XYL5_BCL2L1-      a-----gaaggagatgagc------ccccttgtgggacggattgctgact
A0A3P8XFS0_BCL2L1-      a-----gaaggatatgagc------ctcctagtggcacgtattgcagact
A0A3P8XFS0_BCL2L1-      a-----gaaggatatgagc------ctcctagtggcacgtattgcagact
                        *        * *  *                 *        * *   *  

A0A3P9AAB2_BCL2-01      ggatgacggagtacctgaatggacccctgcaaaactggatccaggagaat
A0A3P8Y1W8_MCL1-01      ccatggcca---------acaacaatacactgaccgagatcaagatcgac
A0A3P8Y1W8_MCL1-02      ccatggcca---------acaacaatacactgaccgagatcaagatcgac
A0A3P8Y1W8_MCL1-03      ccatggcca---------acaacaatacactgaccgagatcaagatcgac
A0A3P8Y1W8_MCL1-04      aaatctccacatacctcctcactgaccaaagggcctggctcgtgaaaaac
A0A3P8Y1W8_MCL1-05      aaatctccacatacctcctcactgaccaaagggcctggctcgtgaaaaac
A0A3P8XYL5_BCL2L1-      ggatgaccgtctacctggataaccacatccagccctggatcgagagccaa
A0A3P8XFS0_BCL2L1-      ggatgaccacctacctggacgaacacatccagccctggatccaaattcaa
A0A3P8XFS0_BCL2L1-      ggatgaccacctacctggacgaacacatccagccctggatccaaattcaa
                          **  *                           *  * **       * 

A0A3P9AAB2_BCL2-01      ggtggatggctgtgttgcacaaacgcct----------------------
A0A3P8Y1W8_MCL1-01      aatcagagacagaagctcggggactcctgcgaaatggagattgccagcat
A0A3P8Y1W8_MCL1-02      aatcagagacagaagctcggggactcctgcgaaatggagattgccagcat
A0A3P8Y1W8_MCL1-03      aatcagagacagaagctcggggactcctgcgaaatggagattgccagcat
A0A3P8Y1W8_MCL1-04      aacgcttgggatggatttgtagagttttttcatgtag-----------aa
A0A3P8Y1W8_MCL1-05      aacgcttgggatggatttgtagagttttttcatgtag-----------aa
A0A3P8XYL5_BCL2L1-      ggaggatgggaccgttttgcagagatctttgggaagg-----------at
A0A3P8XFS0_BCL2L1-      ggaggatgggatcgttttgctgacatttttggcagag-----------at
A0A3P8XFS0_BCL2L1-      ggaggatgggatcgttttgctgacatttttggcagag-----------at
                               *              *    *                      

A0A3P9AAB2_BCL2-01      --------------cccacactctga----------------------tt
A0A3P8Y1W8_MCL1-01      gttggagaacaactccagcatcctaaagatcggctaccactt-----cac
A0A3P8Y1W8_MCL1-02      gttggagaacaactccagcatcctaaagatcggctaccactt-----cac
A0A3P8Y1W8_MCL1-03      gttggagaacaactccagcatcctaaagatcggctaccactt-----cac
A0A3P8Y1W8_MCL1-04      g-----------atccagagtcctcagtaaggaacacccttatggccttt
A0A3P8Y1W8_MCL1-05      g-----------atccagagtcctcagtaaggaacacccttatggccttt
A0A3P8XYL5_BCL2L1-      gctgcagccaacagcaggaagtctcaggagag---------------ctt
A0A3P8XFS0_BCL2L1-      gcagctgcagacatccgacgttcccaagaaag---------------ctt
A0A3P8XFS0_BCL2L1-      gcagctgcagacatccgacgttcccaagaaag---------------ctt
                                      *       *  *                        

A0A3P9AAB2_BCL2-01      ttgcaatgggcctct-----------------------------------
A0A3P8Y1W8_MCL1-01      ccagcaagggcctcgtgccagagcagccatcgcc---atcaccaggaaca
A0A3P8Y1W8_MCL1-02      ccagcaagggcctcgtgccagagcagccatcgcc---atcaccaggaaca
A0A3P8Y1W8_MCL1-03      ccagcaagggcctcgtgccagagcagccatcgcc---atcaccaggaaca
A0A3P8Y1W8_MCL1-04      gcaggagttgctg-gaattggggcaacacttgccctgttaatcagacaga
A0A3P8Y1W8_MCL1-05      gcaggagttgctg-gaattggggcaacacttgccctgttaatcag-----
A0A3P8XYL5_BCL2L1-      taagaagtggctgctggcaggaatgacgctggtt-------acaggagtt
A0A3P8XFS0_BCL2L1-      gaggaaatggctgctatttggggtgatgctgctt-------tcaggagtg
A0A3P8XFS0_BCL2L1-      gaggaaatggctgctatttgggatg-------------------------
                             *   **                                       

A0A3P9AAB2_BCL2-01      --------------------------------------------------
A0A3P8Y1W8_MCL1-01      atgacctgatt---cgtcaacag---------------------------
A0A3P8Y1W8_MCL1-02      atgacctgattg----tctatggttttcctacatgcgatgatctgtcaca
A0A3P8Y1W8_MCL1-03      atgacctgagtgagcatctatag---------------------------
A0A3P8Y1W8_MCL1-04      gtcctgctcacccctggggttgt---------------------------
A0A3P8Y1W8_MCL1-05      --------------------------------------------------
A0A3P8XYL5_BCL2L1-      gtcgttgggtctcttattgctca---------------------------
A0A3P8XFS0_BCL2L1-      ctggttggcactctcctcatgaa---------------------------
A0A3P8XFS0_BCL2L1-      --------------------gaa---------------------------
                                                                          

A0A3P9AAB2_BCL2-01      ---------gagacagatactgggtag----------
A0A3P8Y1W8_MCL1-01      ----------aggctaaga-----tga----------
A0A3P8Y1W8_MCL1-02      taggcgtttcagtttcaca-----tga----------
A0A3P8Y1W8_MCL1-03      -------------------------------------
A0A3P8Y1W8_MCL1-04      ---------gaggcgtgtttgtg-tgaccctagctag
A0A3P8Y1W8_MCL1-05      ----------------------g-tga----------
A0A3P8XYL5_BCL2L1-      ---------gaaacgcctg-----tga----------
A0A3P8XFS0_BCL2L1-      ---------gaaacgccag-----taa----------
A0A3P8XFS0_BCL2L1-      ---------aatgcgcaatggacctga----------
                                                             

© 1998-2021Legal notice