Dataset for CDS BCL-2-like of organism Esox lucius

[Download (right click)] [Edit] [Sequences] [Repertoires]

15 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A6Q2YIU6_BCL2-01      ------------------------atgg----------------------
A0A6Q2XXK6_MCL1-01      ------------------------atga----------------------
A0A6Q2Y9Q3_MCL1-01      ------------------------atga----------------------
A0A6Q2YT18_MCL1-01      ------------------------atga----------------------
A0A6Q2YT18_MCL1-02      ------------------------atga----------------------
A0A6Q2XQM7_MCL1-01      ------------------------atga----------------------
A0A6Q2XQM7_MCL1-02      ----------------------tgtcta----------------------
A0A3P8Y1W8_MCL1-01      ctctcttattcctacagacagaacatgt----caaaaagcgacccacg-g
A0A3P8Y1W8_MCL1-02      --------cttgca-------gacatgt----caaaaagcgacccacg-g
A0A3P8Y1W8_MCL1-03      gaggcgtgtttgt---------acatgt----caaaaagcgacccacg-g
A0A3P8Y1W8_MCL1-04      ------------------------atgaacctgtcgaaatcgcttacacg
A0A3P8Y1W8_MCL1-05      ------------------------atgaacctgtcgaaatcgcttacacg
A0A3P8XYL5_BCL2L1-      ---------------------attatga--------------cttaca--
A0A3P8XFS0_BCL2L1-      ------------------------atgt--------------cttaca--
A0A3P8XFS0_BCL2L1-      ------------------------atgt--------------cttaca--
                                                                          

A0A6Q2YIU6_BCL2-01      ----cagacgacgataaccgttttatagtggaaaag----------taca
A0A6Q2XXK6_MCL1-01      ------------------------------------------gcggagta
A0A6Q2Y9Q3_MCL1-01      ------------------------------------------gcggagta
A0A6Q2YT18_MCL1-01      ------------------------------------------gag-----
A0A6Q2YT18_MCL1-02      ------------------------------------------gag-----
A0A6Q2XQM7_MCL1-01      ------------------------------------------gag-----
A0A6Q2XQM7_MCL1-02      ------------------------------------------gagtgcca
A0A3P8Y1W8_MCL1-01      gacatcgacgaggatgccatcctcaaagggatgagcgctgaggagttaga
A0A3P8Y1W8_MCL1-02      gacatcgacgaggatgccatcctcaaagggatgagcgctgaggagttaga
A0A3P8Y1W8_MCL1-03      gacatcgacgaggatgccatcctcaaagggatgagcgctgaggagttaga
A0A3P8Y1W8_MCL1-04      agccacaactacgatgctcaacgttcaaaatggagt-cgtgggatctttg
A0A3P8Y1W8_MCL1-05      agccacaactacgatgctcaacgttcaaaatggagt-cgtgggatctttg
A0A3P8XYL5_BCL2L1-      ------------------------acaacaaagaac-tggtggcatacta
A0A3P8XFS0_BCL2L1-      ------------------------gtaatagggaac-tggtggtgttttt
A0A3P8XFS0_BCL2L1-      ------------------------gtaatagggaac-tggtggtgttttt
                                                                          

A0A6Q2YIU6_BCL2-01      tttgtcacaaactcttaaaac-----------------------------
A0A6Q2XXK6_MCL1-01      tatccccagggatctaactttaccagccgggtaaccgttacagttaaagg
A0A6Q2Y9Q3_MCL1-01      tatccccagggatctaactttaccagccgggtaaccgttacagttaaagg
A0A6Q2YT18_MCL1-01      --------------------------------------------------
A0A6Q2YT18_MCL1-02      --------------------------------------------------
A0A6Q2XQM7_MCL1-01      --------------------------------------------------
A0A6Q2XQM7_MCL1-02      cgtgccctatgctgtatact------------------------------
A0A3P8Y1W8_MCL1-01      tgcgctggag----tatgagctgcaagagatggac---ccagagaatgcc
A0A3P8Y1W8_MCL1-02      tgcgctggag----tatgagctgcaagagatggac---ccagagaatgcc
A0A3P8Y1W8_MCL1-03      tgcgctggag----tatgagctgcaagagatggac---ccagagaatgcc
A0A3P8Y1W8_MCL1-04      tattctggtgcccctttgtgctattttagcccgacagggccc-ttatgtc
A0A3P8Y1W8_MCL1-05      tattctggtgcccctttgtgctattttagcccgacagggccc-ttatgtc
A0A3P8XYL5_BCL2L1-      tatt-------acctataaactatcccagagaaactaccccatcaatcac
A0A3P8XFS0_BCL2L1-      tata-------aactataaactgtcccagaggaattattcctgttgtgaa
A0A3P8XFS0_BCL2L1-      tata-------aactataaactgtcccagaggaattattcctgttgtgaa
                                                                          

A0A6Q2YIU6_BCL2-01      --------------------------ggggatatgcatg-----------
A0A6Q2XXK6_MCL1-01      gtttggcatatccgcactaaagcgtagagaaagtggtca-----------
A0A6Q2Y9Q3_MCL1-01      gtttggcatatccgcactaaagcgtagagaaagtggtca-----------
A0A6Q2YT18_MCL1-01      --------------------------------------------------
A0A6Q2YT18_MCL1-02      --------------------------------------------------
A0A6Q2XQM7_MCL1-01      --------------------------------------------------
A0A6Q2XQM7_MCL1-02      --------------------------------------------------
A0A3P8Y1W8_MCL1-01      atgctgc----ctgc---agggttccgccagcgtgatca--gaccaagaa
A0A3P8Y1W8_MCL1-02      atgctgc----ctgc---agggttccgccagcgtgatca--gaccaagaa
A0A3P8Y1W8_MCL1-03      atgctgc----ctgc---agggttccgccagcgtgatca--gaccaagaa
A0A3P8Y1W8_MCL1-04      ctgcggcctcttcga---ag------tccaaaatggacgttgatttagg-
A0A3P8Y1W8_MCL1-05      ctgcggcctcttcga---ag------tccaaaatggacgttgatttagg-
A0A3P8XYL5_BCL2L1-      actgggc----tcac---ag------gagcatttgatcg--gactgaggg
A0A3P8XFS0_BCL2L1-      ttggagc----tgga---gg------gtgcaagtggacg--gactgaggg
A0A3P8XFS0_BCL2L1-      ttggagc----tgga---gg------gtgcaagtggacg--gactgaggg
                                                                          

A0A6Q2YIU6_BCL2-01      --------------------------------------------------
A0A6Q2XXK6_MCL1-01      ---------gtacgaatcacctgaggggttgaaatcccataccggacctg
A0A6Q2Y9Q3_MCL1-01      ---------gtacgaatcacctgaggggttgaaatcccataccggacctg
A0A6Q2YT18_MCL1-01      --------------------------------------------------
A0A6Q2YT18_MCL1-02      --------------------------------------------------
A0A6Q2XQM7_MCL1-01      --------------------------------------------------
A0A6Q2XQM7_MCL1-02      --------------------------------------------------
A0A3P8Y1W8_MCL1-01      gagcccg--acaggggttttcgaccgtga-----cgccctgctggatc--
A0A3P8Y1W8_MCL1-02      gagcccg--acaggggttttcgaccgtga-----cgccctgctggatc--
A0A3P8Y1W8_MCL1-03      gagcccg--acaggggttttcgaccgtga-----cgccctgctggatc--
A0A3P8Y1W8_MCL1-04      ---------aaatgggactgctgatactcctgtccgacctacgaagttag
A0A3P8Y1W8_MCL1-05      ---------aaatgggactgctgatactcctgtccgacctacgaagttag
A0A3P8XYL5_BCL2L1-      gggagaggtggaagaggtggcagcagtcaccatgcaccccaatggcac--
A0A3P8XFS0_BCL2L1-      ---------agaagaggctactgca---------------aatgggtc--
A0A3P8XFS0_BCL2L1-      ---------agaagaggctactgca---------------aatgggtc--
                                                                          

A0A6Q2YIU6_BCL2-01      ------------------------ggatttcgaagatgcagagga-----
A0A6Q2XXK6_MCL1-01      atgtcgacaccattcgaattttagtattttca-------aaacag-----
A0A6Q2Y9Q3_MCL1-01      atgtcgacaccattcgaattttagtattttca-------aaacag-----
A0A6Q2YT18_MCL1-01      ------------------------tattttca-------aaatcg-----
A0A6Q2YT18_MCL1-02      ------------------------tattttca-------aaatcg-----
A0A6Q2XQM7_MCL1-01      ------------------------tattttca-------aaatcg-----
A0A6Q2XQM7_MCL1-02      ------------------------tattttca-------aaatcg-----
A0A3P8Y1W8_MCL1-01      acttggagaaaac-----------tgctctagagcatgcggacag-----
A0A3P8Y1W8_MCL1-02      acttggagaaaac-----------tgctctagagcatgcggacag-----
A0A3P8Y1W8_MCL1-03      acttggagaaaac-----------tgctctagagcatgcggacag-----
A0A3P8Y1W8_MCL1-04      aagtaaatatgac-----------gaaacccaacgtattggatagtcgtt
A0A3P8Y1W8_MCL1-05      aagtaaatatgac-----------gaaacccaacgtattggatagtcgtt
A0A3P8XYL5_BCL2L1-      -aatgaatgggac-----------gagtcctg-------ggactc-----
A0A3P8XFS0_BCL2L1-      -tgtgg--ggaac-----------gg---cag-------gaacag-----
A0A3P8XFS0_BCL2L1-      -tgtgg--ggaac-----------gg---cag-------gaacag-----
                                                                 *        

A0A6Q2YIU6_BCL2-01      -ggaagatggtgctaataatgggtcgatgatt------------------
A0A6Q2XXK6_MCL1-01      ---aagatgtcgctaatctc--ccagggaa--------------------
A0A6Q2Y9Q3_MCL1-01      ---aagatgtcgctaatctc--ccagggaa--------------------
A0A6Q2YT18_MCL1-01      ---aagatgtcgctaatctc--ccagggaa--------------------
A0A6Q2YT18_MCL1-02      ---aagatgtcgctaatctc--ccagggaa--------------------
A0A6Q2XQM7_MCL1-01      ---aagatgtcgctaatctc--ccagggaa--------------------
A0A6Q2XQM7_MCL1-02      ---aagatgtcgctaatctc--ccagggaa--------------------
A0A3P8Y1W8_MCL1-01      -agaagacctagtgcccttc--actggagagaagaaagggagagcgtttg
A0A3P8Y1W8_MCL1-02      -agaagacctagtgcccttc--actggagagaagaaagggagagcgtttg
A0A3P8Y1W8_MCL1-03      -agaagacctagtgcccttc--actggagagaagaaagggagagcgtttg
A0A3P8Y1W8_MCL1-04      tgtcagacctggccgacgac--tccgacgactc-----------------
A0A3P8Y1W8_MCL1-05      tgtcagacctggccgacgac--tccgacgactc-----------------
A0A3P8XYL5_BCL2L1-      ---ca-ac-------acaac---------agtc-----------------
A0A3P8XFS0_BCL2L1-      ---cagac-------gcaat--ttgggaaag-------------------
A0A3P8XFS0_BCL2L1-      ---cagac-------gcaat--ttgggaaag-------------------
                            * *                      *                    

A0A6Q2YIU6_BCL2-01      -----------------------------------------tctcctccg
A0A6Q2XXK6_MCL1-01      -----------------------------------------------ccg
A0A6Q2Y9Q3_MCL1-01      -----------------------------------------------ccg
A0A6Q2YT18_MCL1-01      -----------------------------------------------ccg
A0A6Q2YT18_MCL1-02      -----------------------------------------------ccg
A0A6Q2XQM7_MCL1-01      -----------------------------------------------ccg
A0A6Q2XQM7_MCL1-02      -----------------------------------------------ccg
A0A3P8Y1W8_MCL1-01      ttcctaaggagggccacgggcagatccccatcaatgagcagatcaccctg
A0A3P8Y1W8_MCL1-02      ttcctaaggagggccacgggcagatccccatcaatgagcagatcaccctg
A0A3P8Y1W8_MCL1-03      ttcctaaggagggccacgggcagatccccatcaatgagcagatcaccctg
A0A3P8Y1W8_MCL1-04      -----------------------attgccgtgc--------actcccctg
A0A3P8Y1W8_MCL1-05      -----------------------attgccgtgc--------actcccctg
A0A3P8XYL5_BCL2L1-      -----------------------ccccccctca--------tctcctcgg
A0A3P8XFS0_BCL2L1-      ---------------------------ccctca--------actccacag
A0A3P8XFS0_BCL2L1-      ---------------------------ccctca--------actccacag
                                                                       * *

A0A6Q2YIU6_BCL2-01      ccgggtttggtacggcggattcatggggccagtaaag-------------
A0A6Q2XXK6_MCL1-01      gtgagt----------gtatttacgaacgcagaaaca-------------
A0A6Q2Y9Q3_MCL1-01      gtgagt----------gtatttacaaacgcagaaaca-------------
A0A6Q2YT18_MCL1-01      gtgagt----------gtgttgacgaatgcagaaaca-------------
A0A6Q2YT18_MCL1-02      gtgagt----------gtgttgacgaatgcagaaaca-------------
A0A6Q2XQM7_MCL1-01      gtgagt----------gtgttgacgaatgcagaaaca-------------
A0A6Q2XQM7_MCL1-02      gtgagt----------gtgttgacgaatgcagaaaca-------------
A0A3P8Y1W8_MCL1-01      gagcct----------gagcttgaggaggccctgaagaatgctacagatg
A0A3P8Y1W8_MCL1-02      gagcct----------gagcttgaggaggccctgaagaatgctacagatg
A0A3P8Y1W8_MCL1-03      gagcct----------gagcttgaggaggccctgaagaatgctacagatg
A0A3P8Y1W8_MCL1-04      atggtt----------a-----ctgagtgtagtgcgg-------------
A0A3P8Y1W8_MCL1-05      atggtt----------a-----ctgagtgtagtgcgg-------------
A0A3P8XYL5_BCL2L1-      cggact----------gttggcctggatgcagtgaaa-------------
A0A3P8XFS0_BCL2L1-      ggg----------------tgcatggaggcagtgaaa-------------
A0A3P8XFS0_BCL2L1-      ggg----------------tgcatggaggcagtgaaa-------------
                          *                                               

A0A6Q2YIU6_BCL2-01      --------------------------------------------------
A0A6Q2XXK6_MCL1-01      -------------------gagcctc------------------------
A0A6Q2Y9Q3_MCL1-01      -------------------gagcctc------------------------
A0A6Q2YT18_MCL1-01      -------------------gagcctc------------------------
A0A6Q2YT18_MCL1-02      -------------------gagcctc------------------------
A0A6Q2XQM7_MCL1-01      -------------------gagcctc------------------------
A0A6Q2XQM7_MCL1-02      -------------------gagcctc------------------------
A0A3P8Y1W8_MCL1-01      ctgagatgtgtgacatagcagccatcctgggaatgtacacactgatgagc
A0A3P8Y1W8_MCL1-02      ctgagatgtgtgacatagcagccatcctgggaatgtacacactgatgagc
A0A3P8Y1W8_MCL1-03      ctgagatgtgtgacatagcagccatcctgggaatgtacacactgatgagc
A0A3P8Y1W8_MCL1-04      -------ggttatcacattgcccatc--------------------gggc
A0A3P8Y1W8_MCL1-05      -------ggttatcacattgcccatc--------------------gggc
A0A3P8XYL5_BCL2L1-      -------g--aggcactgcgggactc--------------------tgcc
A0A3P8XFS0_BCL2L1-      -------g--cagcactacgggactc--------------------tgca
A0A3P8XFS0_BCL2L1-      -------g--cagcactacgggactc--------------------tgca
                                                                          

A0A6Q2YIU6_BCL2-01      ---------ccggacagggcagcgttc-----cccat-------------
A0A6Q2XXK6_MCL1-01      --------gctggacacgg--agaccaggcaactcgtgaaat--------
A0A6Q2Y9Q3_MCL1-01      --------gctggacacgg--agaccaggcaactcgtgaaat--------
A0A6Q2YT18_MCL1-01      --------gctggacaccg--agaccaggcaactcgtgaaat--------
A0A6Q2YT18_MCL1-02      --------gctggacaccg--agaccaggcaactcgtgaaat--------
A0A6Q2XQM7_MCL1-01      --------gctggacaccg--agaccaggcaactcgtgaaat--------
A0A6Q2XQM7_MCL1-02      --------gctggacaccg--agaccaggcaactcgtgaaat--------
A0A3P8Y1W8_MCL1-01      aacaag---cagtactacg--acgccctgggcaccactggtaccatcgcc
A0A3P8Y1W8_MCL1-02      aacaag---cagtactacg--acgccctgggcaccactggtaccatcgcc
A0A3P8Y1W8_MCL1-03      aacaag---cagtactacg--acgccctgggcaccactggtaccatcgcc
A0A3P8Y1W8_MCL1-04      aatgaggttttggacaacg--ataccagacaactcattgaga--------
A0A3P8Y1W8_MCL1-05      aatgaggttttggacaacg--ataccagacaactcattgaga--------
A0A3P8XYL5_BCL2L1-      aacgag--tttgagctgcgttacgccctagcattcagtgacc--------
A0A3P8XFS0_BCL2L1-      gatgag--tttgagctgcgctacacccgtgccttcagtgatc--------
A0A3P8XFS0_BCL2L1-      gatgag--tttgagctgcgctacacccgtgccttcagtgatc--------
                                   *  *   *               *               

A0A6Q2YIU6_BCL2-01      ----------------------------------atttccaaatggctct
A0A6Q2XXK6_MCL1-01      ----------------------------------ctttcctagaagagtt
A0A6Q2Y9Q3_MCL1-01      ----------------------------------ctttcctagaagagtt
A0A6Q2YT18_MCL1-01      ----------------------------------ctttcctaggagactt
A0A6Q2YT18_MCL1-02      ----------------------------------ctttcctaggagactt
A0A6Q2XQM7_MCL1-01      ----------------------------------ctttcctaggagactt
A0A6Q2XQM7_MCL1-02      ----------------------------------ctttcctaggagactt
A0A3P8Y1W8_MCL1-01      aacacagagggcatcaacagcgtcgtaaaaccagatccattcaagatctt
A0A3P8Y1W8_MCL1-02      aacacagagggcatcaacagcgtcgtaaaaccagatccattcaagatctt
A0A3P8Y1W8_MCL1-03      aacacagagggcatcaacagcgtcgtaaaaccagatccattcaagatctt
A0A3P8Y1W8_MCL1-04      ----------------------------------atttattaagggacta
A0A3P8Y1W8_MCL1-05      ----------------------------------atttattaagggacta
A0A3P8XYL5_BCL2L1-      ----------------------------------tgtcat----------
A0A3P8XFS0_BCL2L1-      ----------------------------------tctcct----------
A0A3P8XFS0_BCL2L1-      ----------------------------------tctcct----------
                                                                          

A0A6Q2YIU6_BCL2-01      cccaaccagacccgcatgcagct--------------------------a
A0A6Q2XXK6_MCL1-01      tactggatgtttgaaacctaggtgtaacgaaagcaaagctctgtcaacaa
A0A6Q2Y9Q3_MCL1-01      tactggatgtttgaaacctaggtgtaacgaaagcaaagctctgtcaacaa
A0A6Q2YT18_MCL1-01      tactgaacatttgaaacctaggtggaacgaaagcaaagctctgtcaacaa
A0A6Q2YT18_MCL1-02      tactgaacatttgaaacctaggtggaacgaaagcaaagctctgtcaacaa
A0A6Q2XQM7_MCL1-01      tactgaacatttgaaacctaggtggaacgaaagcaaagctctgtcaacaa
A0A6Q2XQM7_MCL1-02      tactgaacatttgaaacctaggtggaacgaaagcaaagctctgtcaacaa
A0A3P8Y1W8_MCL1-01      cccagacgagccgcccaaccctacgaatgtggaggagacccttcagcaga
A0A3P8Y1W8_MCL1-02      cccagacgagccgcccaaccctacgaatgtggaggagacccttcagcaga
A0A3P8Y1W8_MCL1-03      cccagacgagccgcccaaccctacgaatgtggaggagacccttcagcaga
A0A3P8Y1W8_MCL1-04      cacaggactgtctcaacctcgttggaaacaaaacaagtctcttgtgacga
A0A3P8Y1W8_MCL1-05      cacaggactgtctcaacctcgttggaaacaaaacaagtctcttgtgacga
A0A3P8XYL5_BCL2L1-      cccagctgcacctcacaccggct---------------------------
A0A3P8XFS0_BCL2L1-      cccagctccacatcacccccgcc---------------------------
A0A3P8XFS0_BCL2L1-      cccagctccacatcacccccgcc---------------------------
                          *                                               

A0A6Q2YIU6_BCL2-01      ttcacagagtgttgcgtgaggccggggacgaactcgaaagactgtaccaa
A0A6Q2XXK6_MCL1-01      tgaaacgagttgtaaccgaaacattagacaaacacagatactcctacaa-
A0A6Q2Y9Q3_MCL1-01      tgaaacgagttgtaaccgaaacattagacaaacacagatactcctacaa-
A0A6Q2YT18_MCL1-01      tgaaacaagttgtcaccaaatcattggacaaacacagatactcatacaa-
A0A6Q2YT18_MCL1-02      tgaaacaagttgtcaccaaatcattggacaaacacagatactcatacaa-
A0A6Q2XQM7_MCL1-01      tgaaacaagttgtcaccaaatcattggacaaacacagatactcatacaa-
A0A6Q2XQM7_MCL1-02      tgaaacaagttgtcaccaaatcattggacaaacacagatactcatacaa-
A0A3P8Y1W8_MCL1-01      tccagactaatgaca--------gcagcctgcttgaagtgaacctcaat-
A0A3P8Y1W8_MCL1-02      tccagactaatgaca--------gcagcctgcttgaagtgaacctcaat-
A0A3P8Y1W8_MCL1-03      tccagactaatgaca--------gcagcctgcttgaagtgaacctcaat-
A0A3P8Y1W8_MCL1-04      tgaaaagagtggtgggcgacgtaatagccaagcacacatacgcatacaa-
A0A3P8Y1W8_MCL1-05      tgaaaagagtggtgggcgacgtaatagccaagcacacatacgcatacaa-
A0A3P8XYL5_BCL2L1-      -----------------------acagcctaccag---------------
A0A3P8XFS0_BCL2L1-      -----------------------acagcctaccac---------------
A0A3P8XFS0_BCL2L1-      -----------------------acagcctaccac---------------
                                                  * *                     

A0A6Q2YIU6_BCL2-01      cccgactttttggagatgtcacaccagctgtatctgacgtcctctgtggc
A0A6Q2XXK6_MCL1-01      -----------tggtatgctctacacactgtccttggat-----------
A0A6Q2Y9Q3_MCL1-01      -----------tggtatgctctacacactgtccttggat-----------
A0A6Q2YT18_MCL1-01      -----------tggtatgctctacagactgtccttgggt-----------
A0A6Q2YT18_MCL1-02      -----------tggtatgctctacagactgtccttgggt-----------
A0A6Q2XQM7_MCL1-01      -----------tggtatgctctacagactgtccttgggt-----------
A0A6Q2XQM7_MCL1-02      -----------tggtatgctctacagactgtccttgggt-----------
A0A3P8Y1W8_MCL1-01      -------------------------aacattaaggacattcccatcccaa
A0A3P8Y1W8_MCL1-02      -------------------------aacattaaggacattcccatcccaa
A0A3P8Y1W8_MCL1-03      -------------------------aacattaaggacattcccatcccaa
A0A3P8Y1W8_MCL1-04      -----------gggtatgatctccaaactttgcttggat-----------
A0A3P8Y1W8_MCL1-05      -----------gggtatgatctccaaactttgcttggat-----------
A0A3P8XYL5_BCL2L1-      -------------------------agctttgcaagtgt-----------
A0A3P8XFS0_BCL2L1-      -------------------------agttttgaaagtgt-----------
A0A3P8XFS0_BCL2L1-      -------------------------agttttgaaagtgt-----------
                                                      *                   

A0A6Q2YIU6_BCL2-01      cgag-----aggagattcagagaggtt-------------atagacgagc
A0A6Q2XXK6_MCL1-01      -gacagcacagggcatgacgtgggattcgtgggtgtagttgctaacaggc
A0A6Q2Y9Q3_MCL1-01      -gacagcacagggcatgacgtgggattcgtgggtgtagttgctaacaggc
A0A6Q2YT18_MCL1-01      -gacagcccaggggattacgtgagattcgtgagtgtaatcgctaacaggc
A0A6Q2YT18_MCL1-02      -gacagcccaggggattacgtgagattcgtgagtgtaatcgctaacaggc
A0A6Q2XQM7_MCL1-01      -gacagcccaggggattacgtgagattcgtgagtgtaatcgctaacaggc
A0A6Q2XQM7_MCL1-02      -gacagcccaggggattacgtgagattcgtgagtgtaatcgctaacaggc
A0A3P8Y1W8_MCL1-01      cgctga---aagaga-----------------------------------
A0A3P8Y1W8_MCL1-02      cgctga---aagaga-----------------------------------
A0A3P8Y1W8_MCL1-03      cgctga---aagaga-----------------------------------
A0A3P8Y1W8_MCL1-04      -gatca---aggggatgacatgggtttcatcacgtctgtggccaagagtc
A0A3P8Y1W8_MCL1-05      -gatca---aggggatgacatgggtttcatcacgtctgtggccaagagtc
A0A3P8XYL5_BCL2L1-      -gatgg---atgagg-----------------------------------
A0A3P8XFS0_BCL2L1-      -gatgg---acgagg-----------------------------------
A0A3P8XFS0_BCL2L1-      -gatgg---acgagg-----------------------------------
                         *       * *                                      

A0A6Q2YIU6_BCL2-01      tgttcagagacggagtt---aac-------tggggac-----gtattatc
A0A6Q2XXK6_MCL1-01      tcttcgcagatggggtcaccaac-------tggggcc-----gggttgtg
A0A6Q2Y9Q3_MCL1-01      tcttcgcagatggggtcaccaac-------tggggcc-----gggttgtg
A0A6Q2YT18_MCL1-01      tcttcgcagatgggaccacaaac-------tggggcc-----gcgttatc
A0A6Q2YT18_MCL1-02      tcttcgcagatgggaccacaaac-------tggggcc-----gcgttatc
A0A6Q2XQM7_MCL1-01      tcttcgcagatgggaccacaaac-------tggggcc-----gcgttgtc
A0A6Q2XQM7_MCL1-02      tcttcgcagatgggaccacaaac-------tggggcc-----gcgttgtc
A0A3P8Y1W8_MCL1-01      tctttgaggcaatgaagaccaacactcacgtggagtctctgagcatcgcc
A0A3P8Y1W8_MCL1-02      tctttgaggcaatgaagaccaacactcacgtggagtctctgagcatcgcc
A0A3P8Y1W8_MCL1-03      tctttgaggcaatgaagaccaacactcacgtggagtctctgagcatcgcc
A0A3P8Y1W8_MCL1-04      tgttcagtgatgggactacaaac-------tggggtc-----gcattgcc
A0A3P8Y1W8_MCL1-05      tgttcagtgatgggactacaaac-------tggggtc-----gcattgcc
A0A3P8XYL5_BCL2L1-      tgttccgggatggggtg---aac-------tggggaa-----gggttgtg
A0A3P8XFS0_BCL2L1-      tgttcagggatggggtt---aac-------tggggtc-----gtgtggtg
A0A3P8XFS0_BCL2L1-      tgttcagggatggggtt---aac-------tggggtc-----gtgtggtg
                        * **    *           ***       *** *       *  *    

A0A6Q2YIU6_BCL2-01      ---------------gctttcttcgagttc--------------------
A0A6Q2XXK6_MCL1-01      ---------------agcctgctcgcattc--------------------
A0A6Q2Y9Q3_MCL1-01      ---------------agcctgctcgcattc--------------------
A0A6Q2YT18_MCL1-01      ---------------agcctgctcgcgttc--------------------
A0A6Q2YT18_MCL1-02      ---------------agcctgctcgcgttc--------------------
A0A6Q2XQM7_MCL1-01      ---------------agcctgctcgcgttc--------------------
A0A6Q2XQM7_MCL1-02      ---------------agcctgctcgcgttc--------------------
A0A3P8Y1W8_MCL1-01      gccacccgtagcaatgaccctgtggcctttgctgttgctgagatgctcca
A0A3P8Y1W8_MCL1-02      gccacccgtagcaatgaccctgtggcctttgctgttgctgagatgctcca
A0A3P8Y1W8_MCL1-03      gccacccgtagcaatgaccctgtggcctttgctgttgctgagatgctcca
A0A3P8Y1W8_MCL1-04      ---------------agcttggtgggcttt--------------------
A0A3P8Y1W8_MCL1-05      ---------------agcttggtgggcttt--------------------
A0A3P8XYL5_BCL2L1-      ---------------ggcctgtttgcgttc--------------------
A0A3P8XFS0_BCL2L1-      ---------------ggcctgtttgctttc--------------------
A0A3P8XFS0_BCL2L1-      ---------------ggcctgtttgctttc--------------------
                                              * *  **                     

A0A6Q2YIU6_BCL2-01      gggggcacaatatgcgtggaat----gcgtgaa-----caaggaaatgac
A0A6Q2XXK6_MCL1-01      ggtgctgc-----------ggt----gtgccggtacctcaaggataaggg
A0A6Q2Y9Q3_MCL1-01      ggtgctgc-----------ggt----gtgccggtacctcaaggataaggg
A0A6Q2YT18_MCL1-01      gggactgt-----------ggt----gtgccggtacctcaaggataaggg
A0A6Q2YT18_MCL1-02      gggactgt-----------ggt----gtgccggtacctcaaggataaggg
A0A6Q2XQM7_MCL1-01      gggactgt-----------ggt----gtgccggtacctcaaggataaggg
A0A6Q2XQM7_MCL1-02      gggactgt-----------ggt----gtgccggtacctcaaggataaggg
A0A3P8Y1W8_MCL1-01      ggagaacaccactctgcagagtcttaacatcga-----gtcgaacttcat
A0A3P8Y1W8_MCL1-02      ggagaacaccactctgcagagtcttaacatcga-----gtcgaacttcat
A0A3P8Y1W8_MCL1-03      ggagaacaccactctgcagagtcttaacatcga-----gtcgaacttcat
A0A3P8Y1W8_MCL1-04      ggggcagt-----------agt----gagtcaacacctgaaggagatggg
A0A3P8Y1W8_MCL1-05      ggggcagt-----------agt----gagtcaacacctgaaggagatggg
A0A3P8XYL5_BCL2L1-      ggaggggccctctgtgtagagt----gcgtgga-----gaaggagatgag
A0A3P8XFS0_BCL2L1-      ggcggggccctatgtgttgagt----gtgttga-----gaaggatatgag
A0A3P8XFS0_BCL2L1-      ggcggggccctatgtgttgagt----gtgttga-----gaaggatatgag
                        **                   *                   * *      

A0A6Q2YIU6_BCL2-01      t------tcgcaggtggaccacattgccgggtggatgacagaatatctaa
A0A6Q2XXK6_MCL1-01      caaagagaactgtgtggaagcggtgggacaagagatctccatgcacctac
A0A6Q2Y9Q3_MCL1-01      caaagagaactgtgtggaagcggtgggacaagagatctccatgcacctac
A0A6Q2YT18_MCL1-01      caaagacaactgtgtggaagcggtgggacaggagatctccatgtacctac
A0A6Q2YT18_MCL1-02      caaagacaactgtgtggaagcggtgggacaggagatctccatgtacctac
A0A6Q2XQM7_MCL1-01      caaagacaactgtgtggaagcggtgggacaggagatctccatgtacctac
A0A6Q2XQM7_MCL1-02      caaagacaactgtgtggaagcggtgggacaggagatctccatgtacctac
A0A3P8Y1W8_MCL1-01      caccagtgagggcatgacggccattgtcaaggccatggcca---------
A0A3P8Y1W8_MCL1-02      caccagtgagggcatgacggccattgtcaaggccatggcca---------
A0A3P8Y1W8_MCL1-03      caccagtgagggcatgacggccattgtcaaggccatggcca---------
A0A3P8Y1W8_MCL1-04      caagggaaactgcgttgagttggttggccaagaaatctccacatacctcc
A0A3P8Y1W8_MCL1-05      caagggaaactgcgttgagttggttggccaagaaatctccacatacctcc
A0A3P8XYL5_BCL2L1-      c------ccccttgtgggacggattgctgactggatgaccgtctacctgg
A0A3P8XFS0_BCL2L1-      c------ctcctagtggcacgtattgcagactggatgaccacctacctgg
A0A3P8XFS0_BCL2L1-      c------ctcctagtggcacgtattgcagactggatgaccacctacctgg
                                      *        * *        **  *           

A0A6Q2YIU6_BCL2-01      atggacccctgcacagctggattcaagaaaacgggggatgggaggccttt
A0A6Q2XXK6_MCL1-01      tgaccgaccataaagactggctggtcaaaaacaactcatgggacggattc
A0A6Q2Y9Q3_MCL1-01      tgaccgaccataaagactggctggtcaaaaacaactcatgggacggattc
A0A6Q2YT18_MCL1-01      tgacagaccagagagactggctggtaaaaaacaactcctgggacggattc
A0A6Q2YT18_MCL1-02      tgacagaccagagagactggctggtaaaaaacaactcctgggacggattc
A0A6Q2XQM7_MCL1-01      tgacagaccagagagactggctggtaaaaaacaactcctgggacggattc
A0A6Q2XQM7_MCL1-02      tgacagaccagagagactggctggtaaaaaacaactcctgggacggattc
A0A3P8Y1W8_MCL1-01      acaacaatacactgaccgagatcaagatcgacaatcagagacagaagctc
A0A3P8Y1W8_MCL1-02      acaacaatacactgaccgagatcaagatcgacaatcagagacagaagctc
A0A3P8Y1W8_MCL1-03      acaacaatacactgaccgagatcaagatcgacaatcagagacagaagctc
A0A3P8Y1W8_MCL1-04      tcactgaccaaagggcctggctcgtgaaaaacaacgcttgggatggattt
A0A3P8Y1W8_MCL1-05      tcactgaccaaagggcctggctcgtgaaaaacaacgcttgggatggattt
A0A3P8XYL5_BCL2L1-      ataaccacatccagccctggatcgagagccaaggaggatgggaccgtttt
A0A3P8XFS0_BCL2L1-      acgaacacatccagccctggatccaaattcaaggaggatgggatcgtttt
A0A3P8XFS0_BCL2L1-      acgaacacatccagccctggatccaaattcaaggaggatgggatcgtttt
                                        *  * *        *        *  *     * 

A0A6Q2YIU6_BCL2-01      gtggagctctatgacagacagagggactctgtgttct-------gttcat
A0A6Q2XXK6_MCL1-01      gtcgagttctttcgggtag-------------------------cagagg
A0A6Q2Y9Q3_MCL1-01      gtcgagttctttcgggtag-------------------------cagagg
A0A6Q2YT18_MCL1-01      gtggagttctttcgggtag-------------------------cagagg
A0A6Q2YT18_MCL1-02      gtggagttctttcgggtag-------------------------cagagg
A0A6Q2XQM7_MCL1-01      gtggagttctttcgggtag-------------------------cagagg
A0A6Q2XQM7_MCL1-02      gtggagttctttcgggtag-------------------------cagagg
A0A3P8Y1W8_MCL1-01      ggggactcctgcgaaatggagattgccagcatgttggagaacaactccag
A0A3P8Y1W8_MCL1-02      ggggactcctgcgaaatggagattgccagcatgttggagaacaactccag
A0A3P8Y1W8_MCL1-03      ggggactcctgcgaaatggagattgccagcatgttggagaacaactccag
A0A3P8Y1W8_MCL1-04      gtagagttttttcatgtag-----------aag-----------atccag
A0A3P8Y1W8_MCL1-05      gtagagttttttcatgtag-----------aag-----------atccag
A0A3P8XYL5_BCL2L1-      gcagagatctttgggaagg-----------atgctgcagccaacagcagg
A0A3P8XFS0_BCL2L1-      gctgacatttttggcagag-----------atgcagctgcagacatccga
A0A3P8XFS0_BCL2L1-      gctgacatttttggcagag-----------atgcagctgcagacatccga
                        *  **    *                                        

A0A6Q2YIU6_BCL2-01      ggccctccatcaagactgtctttggcctggctgcactgggggctgcaagc
A0A6Q2XXK6_MCL1-01      agtctacattgagaaacgtactcgtaacatttgctgcatttgctg-gctt
A0A6Q2Y9Q3_MCL1-01      agtctacattgagaaacgtactcgtaacatttgctgcatttgctg-tgtc
A0A6Q2YT18_MCL1-01      agtctacattgagaaacgtactcctaa---------catttg--------
A0A6Q2YT18_MCL1-02      agtctacattgagaaacgtactcctaa---------catttgctg-gctt
A0A6Q2XQM7_MCL1-01      agtctacattgagaaacgtactcctaa---------catttgctg-gctt
A0A6Q2XQM7_MCL1-02      agtctacattgagaaacgtactcctaa---------catttgctg-gctt
A0A3P8Y1W8_MCL1-01      catcctaaagatcggctaccactt-----cacccagcaagggcctcgtgc
A0A3P8Y1W8_MCL1-02      catcctaaagatcggctaccactt-----cacccagcaagggcctcgtgc
A0A3P8Y1W8_MCL1-03      catcctaaagatcggctaccactt-----cacccagcaagggcctcgtgc
A0A3P8Y1W8_MCL1-04      agtcctcagtaaggaacacccttatggcctttgcaggagttgctg-gaat
A0A3P8Y1W8_MCL1-05      agtcctcagtaaggaacacccttatggcctttgcaggagttgctg-gaat
A0A3P8XYL5_BCL2L1-      aagtctcaggagag---------------ctttaagaagtggctgctggc
A0A3P8XFS0_BCL2L1-      cgttcccaagaaag---------------cttgaggaaatggctgctatt
A0A3P8XFS0_BCL2L1-      cgttcccaagaaag---------------cttgaggaaatggctgctatt
                                                                 *        

A0A6Q2YIU6_BCL2-01      ctcaccattggagcataccttacacagaag--------------------
A0A6Q2XXK6_MCL1-01      ttgggcagcgctggtcatgttggacatg----------------------
A0A6Q2Y9Q3_MCL1-01      aatggta-cact----atattagggctgtgtac-----------------
A0A6Q2YT18_MCL1-01      ----------------atgtagtata----------cactctgtggatcc
A0A6Q2YT18_MCL1-02      cagggcagcgctggccatgttgaaaatgtatgtggtcactggaaagaatt
A0A6Q2XQM7_MCL1-01      cggggcagcgctggccatgttgaaaa------tggtcg------------
A0A6Q2XQM7_MCL1-02      cggggcagcgctggccatgttgaaaatgtatgtggtcactggaaagagtt
A0A3P8Y1W8_MCL1-01      cagagcagccatcgcc---atcaccaggaacaatgacctgatt---cgtc
A0A3P8Y1W8_MCL1-02      cagagcagccatcgcc---atcaccaggaacaatgacctgattg----tc
A0A3P8Y1W8_MCL1-03      cagagcagccatcgcc---atcaccaggaacaatgacctgagtgagcatc
A0A3P8Y1W8_MCL1-04      tggggcaacacttgccctgttaatcagacagagtcctgctcacccctggg
A0A3P8Y1W8_MCL1-05      tggggcaacacttgccctgttaatcag-----------------------
A0A3P8XYL5_BCL2L1-      aggaatgacgctggtt-------acaggagttgtcgttgggtctcttatt
A0A3P8XFS0_BCL2L1-      tggggtgatgctgctt-------tcaggagtgctggttggcactctcctc
A0A3P8XFS0_BCL2L1-      tgggatg-------------------------------------------
                                                                          

A0A6Q2YIU6_BCL2-01      --------------------------------------------------
A0A6Q2XXK6_MCL1-01      --------------------------------------------------
A0A6Q2Y9Q3_MCL1-01      --------------------------------------------------
A0A6Q2YT18_MCL1-01      gtttttct------------------------------------------
A0A6Q2YT18_MCL1-02      tgtacatg------------------------------------------
A0A6Q2XQM7_MCL1-01      ggtaccaa------------------------------------------
A0A6Q2XQM7_MCL1-02      tgtacatg------------------------------------------
A0A3P8Y1W8_MCL1-01      aacag-------------------------------------aggctaag
A0A3P8Y1W8_MCL1-02      tatggttttcctacatgcgatgatctgtcacataggcgtttcagtttcac
A0A3P8Y1W8_MCL1-03      tatag---------------------------------------------
A0A3P8Y1W8_MCL1-04      gttgt------------------------------------gaggcgtgt
A0A3P8Y1W8_MCL1-05      --------------------------------------------------
A0A3P8XYL5_BCL2L1-      gctca------------------------------------gaaacgcct
A0A3P8XFS0_BCL2L1-      atgaa------------------------------------gaaacgcca
A0A3P8XFS0_BCL2L1-      --gaa------------------------------------aatgcgcaa
                                                                          

A0A6Q2YIU6_BCL2-01      ------tga----------
A0A6Q2XXK6_MCL1-01      ------taa----------
A0A6Q2Y9Q3_MCL1-01      ------tga----------
A0A6Q2YT18_MCL1-01      ------tag----------
A0A6Q2YT18_MCL1-02      ------tag----------
A0A6Q2XQM7_MCL1-01      ------tag----------
A0A6Q2XQM7_MCL1-02      ------tag----------
A0A3P8Y1W8_MCL1-01      a-----tga----------
A0A3P8Y1W8_MCL1-02      a-----tga----------
A0A3P8Y1W8_MCL1-03      -------------------
A0A3P8Y1W8_MCL1-04      ttgtg-tgaccctagctag
A0A3P8Y1W8_MCL1-05      ----g-tga----------
A0A3P8XYL5_BCL2L1-      g-----tga----------
A0A3P8XFS0_BCL2L1-      g-----taa----------
A0A3P8XFS0_BCL2L1-      tggacctga----------
                                           

© 1998-2021Legal notice