Dataset for CDS BCL-2-like of organism Esox lucius

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3P9AAB2_BCL2-01      ---atggcaaacgagaatccatatgacagtcgcgtcattgtcgaaaatta
A0A3P8XYL5_BCL2L1-      attatgacttacaaca----acaaagaactggtggcata--------cta
A0A3P8XFS0_BCL2L1-      ---atgtcttacagta----atagggaactggtggtgtt--------ttt
A0A3P8XFS0_BCL2L1-      ---atgtcttacagta----atagggaactggtggtgtt--------ttt
                           *** *  **   *    * *    * * * *   *          * 

A0A3P9AAB2_BCL2-01      catctatgataaactgtt---gaagaatggatttgtttgggaattt----
A0A3P8XYL5_BCL2L1-      tattacctataaactatcccagagaaactaccccatcaatcacactgggc
A0A3P8XFS0_BCL2L1-      tataaactataaactgtcccagaggaattattcctgttgtgaattggagc
A0A3P8XFS0_BCL2L1-      tataaactataaactgtcccagaggaattattcctgttgtgaattggagc
                         **     ******* *    **  **              *        

A0A3P9AAB2_BCL2-01      -----------------caaacagagaaccaatctcgaaataacgtcttt
A0A3P8XYL5_BCL2L1-      tcacaggagcatttgatcggactgaggggggagaggtggaagaggtggca
A0A3P8XFS0_BCL2L1-      tggagggtgcaagtggacggactgaggg---------agaagaggctact
A0A3P8XFS0_BCL2L1-      tggagggtgcaagtggacggactgaggg---------agaagaggctact
                                         *  ** ***             *  * *     

A0A3P9AAB2_BCL2-01      gaggatccctctccccccaactcccccgaactttttgcacggaggctcca
A0A3P8XYL5_BCL2L1-      gcagtcaccatgcaccccaatggcac--aatgaatgggacgagtcctggg
A0A3P8XFS0_BCL2L1-      gca---------------aatgggtc--tgtgg--ggaacgg---cagga
A0A3P8XFS0_BCL2L1-      gca---------------aatgggtc--tgtgg--ggaacgg---cagga
                        *                 **     *          * ***    *    

A0A3P9AAB2_BCL2-01      acctc--ccgccgctggcgaggacaacgaccctcagttcgcaaataggat
A0A3P8XYL5_BCL2L1-      actcca-acacaac-------agtcccccccctcatct------------
A0A3P8XFS0_BCL2L1-      acagcagacgcaatttgggaaag------ccctcaact------------
A0A3P8XFS0_BCL2L1-      acagcagacgcaatttgggaaag------ccctcaact------------
                        **  *   * *                  ******  *            

A0A3P9AAB2_BCL2-01      cccgcaaccggacccgcacgcccggctccacaga-----gtcctccgcga
A0A3P8XYL5_BCL2L1-      -cctcgg--cggactgttggcctggatgcagtgaaagaggcactgcggga
A0A3P8XFS0_BCL2L1-      -ccacag--ggg------tgcatggaggcagtgaaagcagcactacggga
A0A3P8XFS0_BCL2L1-      -ccacag--ggg------tgcatggaggcagtgaaagcagcactacggga
                         ** *     *        **  **   **  **     *  ** ** **

A0A3P9AAB2_BCL2-01      tgccgggaacgagatcgaaagaatgtatcagcgggactttgcagagatgt
A0A3P8XYL5_BCL2L1-      ctctgccaacgagtttgagctgcgttacgccctagcattcagtgacctgt
A0A3P8XFS0_BCL2L1-      ctctgcagatgagtttgagctgcgctacacccgtgccttcagtgatctct
A0A3P8XFS0_BCL2L1-      ctctgcagatgagtttgagctgcgctacacccgtgccttcagtgatctct
                          * *   * *** * **       **    *  *  **    **  * *

A0A3P9AAB2_BCL2-01      cggggcagttgcatattacgcccagcacggcacatggacgatttaccgca
A0A3P8XYL5_BCL2L1-      catcccagctgcacctcacaccggctacagcctaccagagctttgcaagt
A0A3P8XFS0_BCL2L1-      cctcccagctccacatcacccccgccacagcctaccacagttttgaaagt
A0A3P8XFS0_BCL2L1-      cctcccagctccacatcacccccgccacagcctaccacagttttgaaagt
                        *    *** * **  * ** **    ** **  *     * ***      

A0A3P9AAB2_BCL2-01      gtaatagacgaactgttcagcgacggtgtaaactggggtcggattgtggc
A0A3P8XYL5_BCL2L1-      gtgatggatgaggtgttccgggatggggtgaactggggaagggttgtggg
A0A3P8XFS0_BCL2L1-      gtgatggacgaggtgttcagggatggggttaactggggtcgtgtggtggg
A0A3P8XFS0_BCL2L1-      gtgatggacgaggtgttcagggatggggttaactggggtcgtgtggtggg
                        ** ** ** **  ***** * ** ** ** ********  *  * **** 

A0A3P9AAB2_BCL2-01      tttccttgagtttggagggacaatgtgcgtggagagcgtcaaccgggaga
A0A3P8XYL5_BCL2L1-      cctgtttgcgttcggaggggccctctgtgtagagtgcgtggagaaggaga
A0A3P8XFS0_BCL2L1-      cctgtttgctttcggcggggccctatgtgttgagtgtgttgagaaggata
A0A3P8XFS0_BCL2L1-      cctgtttgctttcggcggggccctatgtgttgagtgtgttgagaaggata
                          *  ***  ** ** *** *  * ** ** *** * **  *   *** *

A0A3P9AAB2_BCL2-01      tgacgccccaggtgaacaacatcgtccattggatgacggagtacctgaat
A0A3P8XYL5_BCL2L1-      tgagcccccttgtgggacggattgctgactggatgaccgtctacctggat
A0A3P8XFS0_BCL2L1-      tgagcctcctagtggcacgtattgcagactggatgaccacctacctggac
A0A3P8XFS0_BCL2L1-      tgagcctcctagtggcacgtattgcagactggatgaccacctacctggac
                        ***  * **  ***      ** *   * ********    ****** * 

A0A3P9AAB2_BCL2-01      ggacccctgcaaaactggatccaggagaatggtggatgg--ctgtgttgc
A0A3P8XYL5_BCL2L1-      aaccacatccagccctggatcgagagccaaggaggatgggaccgttttgc
A0A3P8XFS0_BCL2L1-      gaacacatccagccctggatccaaattcaaggaggatgggatcgttttgc
A0A3P8XFS0_BCL2L1-      gaacacatccagccctggatccaaattcaaggaggatgggatcgttttgc
                           * * * **   ******* *     * ** ******    ** ****

A0A3P9AAB2_BCL2-01      acaaac----------------gcctcccacactctgattttgcaatggg
A0A3P8XYL5_BCL2L1-      agagatctttgggaaggatgctgcagccaacagcaggaagtctcaggaga
A0A3P8XFS0_BCL2L1-      tgacatttttggcagagatgcagctgcagacatccgacgttcccaagaaa
A0A3P8XFS0_BCL2L1-      tgacatttttggcagagatgcagctgcagacatccgacgttcccaagaaa
                          * *                 **  *  ***        *  **     

A0A3P9AAB2_BCL2-01      cctctgaga-----cagatactggg-------------------------
A0A3P8XYL5_BCL2L1-      gctttaagaagtggctgctggcaggaatgacgctggttacaggagttgtc
A0A3P8XFS0_BCL2L1-      gcttgaggaaatggctgctatttgggatg---------------------
A0A3P8XFS0_BCL2L1-      gcttgaggaaatggctgctatttggggtgatgctgctttcaggagtgctg
                         **    **     * * *    **                         

A0A3P9AAB2_BCL2-01      -----------------------------------tag
A0A3P8XYL5_BCL2L1-      gttgggtctcttattgctcagaaacgcctg-----tga
A0A3P8XFS0_BCL2L1-      -----------------gaaaatgcgcaatggacctga
A0A3P8XFS0_BCL2L1-      gttggcactctcctcatgaagaaacgccag-----taa
                                                           *  

© 1998-2020Legal notice