Dataset for CDS BCL-2-like of organism Amphiprion percula

[Download (right click)] [Edit] [Sequences] [Repertoires]

7 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3P8S9L3_BCL2-01      atg------------------------------------gcgaacgagtg
A0A3P8RQX7_MCL1-01      atgaatatgattccgacgacgacgaagaggacggcgttcatgaactactt
A0A3P8RQX7_MCL1-02      atgaatatgattccgacgacgacgaagaggacggcgttcatgaactactt
A0A3P8RL82_BCL2L10      atg-------tcctgtgggctatggaaaga-----------gacct--tg
A0A3P8TL99_BCL2L1-      atg-------tctca--------gaacaga-----------gaactggtg
A0A3P8TL99_BCL2L1-      atg-------tctca--------gaacaga-----------gaactggtg
A0A3P8U812_BCL2L1-      atg-------tcgtacag-----taacaga-----------gagctggtg
                        ***                                      ** *   * 

A0A3P8S9L3_BCL2-01      taatcgcaatattgtagaaaagt---------------------------
A0A3P8RQX7_MCL1-01      -------aatttttcctcaaaatggagtcgtggagggaccgatgcactat
A0A3P8RQX7_MCL1-02      -------aatttttcctcaaaatggagtcgtggagggaccgatgcactat
A0A3P8RL82_BCL2L10      -------g---tcctggcagagg---------------------------
A0A3P8TL99_BCL2L1-      -------gttttctacataaagt---------------------------
A0A3P8TL99_BCL2L1-      -------gttttctacataaagt---------------------------
A0A3P8U812_BCL2L1-      -------gagttctttgtaagct---------------------------
                                   *      *                               

A0A3P8S9L3_BCL2-01      ---------------------------------atatctgccataaactc
A0A3P8RQX7_MCL1-01      ggatccggagattcctccccgcagattgccgtggcctcctccatagactc
A0A3P8RQX7_MCL1-02      ggatccggagattcctccccgcagattgccgtggcctcctccatagactc
A0A3P8RL82_BCL2L10      ------------------------------------------actacctg
A0A3P8TL99_BCL2L1-      ------------------------------------------ataaactc
A0A3P8TL99_BCL2L1-      ------------------------------------------ataaactc
A0A3P8U812_BCL2L1-      ------------------------------------------acaagctg
                                                                  *    ** 

A0A3P8S9L3_BCL2-01      tccaaacggggctacgt---------gtgggggtttgatgatgtccggga
A0A3P8RQX7_MCL1-01      tcacaacgggaatgttg----gctccagtgaaaccccaaaacggc--cga
A0A3P8RQX7_MCL1-02      tcacaacgggaatgttg----gctccagtgaaaccccaaaacggc--cga
A0A3P8RL82_BCL2L10      tccctgtg---ctgtgc------------aagcccacatcaagc------
A0A3P8TL99_BCL2L1-      tcccagagaaactatcc----cctc------aaccacatggtgct--gaa
A0A3P8TL99_BCL2L1-      tcccagagaaactatcc----cctc------aaccacatggtgct--gaa
A0A3P8U812_BCL2L1-      tctcaaaggaactatccgacgtctctgctgaggccagaggatgct--gaa
                        **     *    *                        *    *       

A0A3P8S9L3_BCL2-01      tgaagatgctgctaataacgggtcagtagtggaccctccgc--------c
A0A3P8RQX7_MCL1-01      agaacct------gggagtgaatgggtatgcgtccaaa-----------a
A0A3P8RQX7_MCL1-02      agaacct------gggagtgaatgggtatgcgtccaaa-----------a
A0A3P8RL82_BCL2L10      ---------------------------------ccctc-----------c
A0A3P8TL99_BCL2L1-      tgaggctcccagcaggactgacgggggggaggcccggctgggagaggaac
A0A3P8TL99_BCL2L1-      tgaggctcccagcaggactgacgggggggaggcccggctgggagaggaac
A0A3P8U812_BCL2L1-      gga----------aggactgatggggacaagg-ccaact----------c

A0A3P8S9L3_BCL2-01      gactttggtccgtcggtgccatgaagccagcaccgggcccgacaacgaga
A0A3P8RQX7_MCL1-01      accttcgacaagacagcgac----agtatggaggagggctctttac---c
A0A3P8RQX7_MCL1-02      accttcgacaagacagcgac----agtatggaggagggctctttac---c
A0A3P8RL82_BCL2L10      acctcc-------cagcga---------------------gtcagcg-gc
A0A3P8TL99_BCL2L1-      agcgga-------cagagac----acacgccaacgggacttttaacg-gc
A0A3P8TL99_BCL2L1-      agcgga-------cagagac----acacgccaacgggacttttaacg-gc
A0A3P8U812_BCL2L1-      agcttc-------cag--------------------------taacg-gc
                          *          * *                             *    

A0A3P8S9L3_BCL2-01      gcgacccccacctctgcagacggctcccccagtccgacccgcacgctgcc
A0A3P8RQX7_MCL1-01      gtgcaccccggagctgc-------------agtcggacagtgaaaccgac
A0A3P8RQX7_MCL1-02      gtgcaccccggagctgc-------------agtcggacagtgaaaccgac
A0A3P8RL82_BCL2L10      t-----------------------gccatgaggcgtctggcccagga---
A0A3P8TL99_BCL2L1-      acgagtcccgggacccccccgccgtccccgcggcggctggcgtcgacggc
A0A3P8TL99_BCL2L1-      acgagtcccgggacccccccgccgtccccgcggcggctggcgtcgacggc
A0A3P8U812_BCL2L1-      ttgc--------------------------tggtgaacagcagaggtgg-

A0A3P8S9L3_BCL2-01      atccacagagt------------------cctgcgggaggctggagatga
A0A3P8RQX7_MCL1-01      gtctccagttgtccagcaggagacgagttgctggagaatgacacgaggca
A0A3P8RQX7_MCL1-02      gtctccagttgtccagcaggagacgagttgctggagaatgacacgaggca
A0A3P8RL82_BCL2L10      ---catggag-------aagcagc-----ac------------caggctc
A0A3P8TL99_BCL2L1-      gaccatggacgcggtgaaggaggc-----cctccgggacacggccaacga
A0A3P8TL99_BCL2L1-      gaccatggacgcggtgaaggaggc-----cctccgggacacggccaacga
A0A3P8U812_BCL2L1-      ---catagaggctgtaaaatccgc-----acttaaggacgcggcagatga
                               *                      *                   

A0A3P8S9L3_BCL2-01      acttgaaagactgtaccagccggacttcacggagat--------------
A0A3P8RQX7_MCL1-01      actccttcgccgtttcttaagagactttactggactttcaaagccccggt
A0A3P8RQX7_MCL1-02      actccttcgccgtttcttaagagactttactggactttcaaagccccggt
A0A3P8RL82_BCL2L10      gcttccactcc--ctcactcagaccttcctgaggca--------------
A0A3P8TL99_BCL2L1-      gttcgagctgcggtacgcccgtgccttcagcgacct--------------
A0A3P8TL99_BCL2L1-      gttcgagctgcggtacgcccgtgccttcagcgacct--------------
A0A3P8U812_BCL2L1-      gtttgaacttctcttcacgcaggcttttagtgatct--------------
                          *       *    *         **                       

A0A3P8S9L3_BCL2-01      --------------gtccaggcagc--------------tgtatctcacc
A0A3P8RQX7_MCL1-01      ggaatgaaagcaaagcattatcaacaatgaaaagagttgtggatgacgtt
A0A3P8RQX7_MCL1-02      ggaatgaaagcaaagcattatcaacaatgaaaagagttgtggatgacgtt
A0A3P8RL82_BCL2L10      --------------gtgcgg---gc--------------cggacct----
A0A3P8TL99_BCL2L1-      --------------gcacagccagc--------------tgcacatcacg
A0A3P8TL99_BCL2L1-      --------------gcacagccagc--------------tgcacatcacg
A0A3P8U812_BCL2L1-      --------------gtcttcacagc--------------ttgacatcacc
                                      *         *                 *       

A0A3P8S9L3_BCL2-01      tccaccacggcgcagaggagattcgccgaggtgat---------------
A0A3P8RQX7_MCL1-01      ttggacaaacacagatacgcatacaatggtatgatcaacaaactgtcgct
A0A3P8RQX7_MCL1-02      ttggacaaacacagatacgcatacaatggtatgatcaacaaactgtcgct
A0A3P8RL82_BCL2L10      -----------ctgctccagcctcaggaaggtgat---------------
A0A3P8TL99_BCL2L1-      cccgccaccgcctaccagagcttcgagaacgtgat---------------
A0A3P8TL99_BCL2L1-      cccgccaccgcctaccagagcttcgagaacgtgat---------------
A0A3P8U812_BCL2L1-      cctgaaacagcctaccacagctttaagagtgtgat---------------

A0A3P8S9L3_BCL2-01      ------------agacgaactg----------------------------
A0A3P8RQX7_MCL1-01      ggatgacagaggggatgatgtgtcgtttgtcagtgcagtagccaagagcc
A0A3P8RQX7_MCL1-02      ggatgacagaggggatgatgtgtcgtttgtcagtgcagtagccaagagcc
A0A3P8RL82_BCL2L10      ------------ggaggagctg----------------------------
A0A3P8TL99_BCL2L1-      ------------ggatgaggtg----------------------------
A0A3P8TL99_BCL2L1-      ------------ggatgaggtg----------------------------
A0A3P8U812_BCL2L1-      ------------ggacgaggtg----------------------------
                                     ** **  **                            

A0A3P8S9L3_BCL2-01      --ttccgggacgg---ggtgaactggggccggattatcgctttcttcgag
A0A3P8RQX7_MCL1-01      tctttgcagacaggacgaccaactggggtcgtattacgagcctggtggcc
A0A3P8RQX7_MCL1-02      tctttgcagacaggacgaccaactggggtcgtattacgagcctggtggcc
A0A3P8RL82_BCL2L10      --gtgggagatggacacttgaactgggggagggttgtttctcttttcacc
A0A3P8TL99_BCL2L1-      --ttccgggacgg---cgtcaactggggccgcatcgtggggctgttcgcg
A0A3P8TL99_BCL2L1-      --ttccgggacgg---cgtcaactggggccgcatcgtggggctgttcgcg
A0A3P8U812_BCL2L1-      --ttcaaggatgg---ggtcaactggggacgtatagtgggcctgttttgc
                           *    **  *       ********  *  *        *  *    

A0A3P8S9L3_BCL2-01      ttcggggggacggtg----------tgcgtcgagtgcgcggccaaagagg
A0A3P8RQX7_MCL1-01      tttggggcggtggtatgtcagtacctgaaggagaggggcag---ggagaa
A0A3P8RQX7_MCL1-02      tttggggcggtggtatgtcagtacctgaaggagaggggcag---ggagaa
A0A3P8RL82_BCL2L10      tttactggggtgctggccagacagctgc-tggagcagaagg---acacaa
A0A3P8TL99_BCL2L1-      ttcggcggggcgctg----------tgtgtcgagtgcgtgg---agaagg
A0A3P8TL99_BCL2L1-      ttcggcggggcgctg----------tgtgtcgagtgcgtgg---agaagg
A0A3P8U812_BCL2L1-      tttggcggtgtactg----------tgtgtggaatgcgtag---ataaga
                        **    *      *           **             *         

A0A3P8S9L3_BCL2-01      agatgacatcgcaggtg-gacaaca------------------------t
A0A3P8RQX7_MCL1-01      ctgcgtg-gacctggtcagccagga-------------------------
A0A3P8RQX7_MCL1-02      ctgcgtg-gacctggtcagccagga-------------------------
A0A3P8RL82_BCL2L10      agccggg---gctggac-cccgggaagcagcaggaactgggacaggggcc
A0A3P8TL99_BCL2L1-      agatgagccccctggtg-ggcagga------------------------t
A0A3P8TL99_BCL2L1-      agatgagccccctggtg-ggcagga------------------------t
A0A3P8U812_BCL2L1-      atatgagtgagctggtt-ccccgca------------------------t
                            *      * **     *   *                         

A0A3P8S9L3_BCL2-01      cgcggagtg------------------gatgacggagtatttaaatggac
A0A3P8RQX7_MCL1-01      ---------------------------gatttccacatacctgctttctg
A0A3P8RQX7_MCL1-02      ---------------------------gatttccacatacctgctttctg
A0A3P8RL82_BCL2L10      cgtaaactgcagagaactggcagagaccatagctgattacctgggagagg
A0A3P8TL99_BCL2L1-      cgtagagtg------------------gatgaccgtctacctggacaacc
A0A3P8TL99_BCL2L1-      cgtagagtg------------------gatgaccgtctacctggacaacc
A0A3P8U812_BCL2L1-      cgctgactg------------------gatgaccatgtacctggatgagc
                                                    **  *    **  *        

A0A3P8S9L3_BCL2-01      ctcttaacagctggatacaagataacgggggatgggatgcctttgtggag
A0A3P8RQX7_MCL1-01      aacagcgagactggctggtcaaaaacaactcatgggatggttttgtggag
A0A3P8RQX7_MCL1-02      aacagcgagactggctggtcaaaaacaactcatgggatggttttgtggag
A0A3P8RL82_BCL2L10      agaagaaagactggctgttggagaatgatggatgggaaggcttctgtaaa
A0A3P8TL99_BCL2L1-      acattcaggactggatccagagccaaggaggatgggagcgttttgctgaa
A0A3P8TL99_BCL2L1-      acattcaggactggatccagagccaaggaggatgggagcgttttgctgaa
A0A3P8U812_BCL2L1-      acatcagtccgtggatccaaagccaaggaggatgggagtgctttgctgag
                                   *** *        *      ******    **     * 

A0A3P8S9L3_BCL2-01      ctgt--------------atgacagacagagggactcagtcttcagttgc
A0A3P8RQX7_MCL1-01      ttttttcg---------agtagcagaccctgagttgacgg--tcag----
A0A3P8RQX7_MCL1-02      ttttttcg---------agtagcagaccctgagttgacgg--tcag----
A0A3P8RL82_BCL2L10      ttctcc--------ctcagtgccaga----gaggtgag----tcag----
A0A3P8TL99_BCL2L1-      atcttcggtcaggacgcggcggccga----gagcaggaagtctcag----
A0A3P8TL99_BCL2L1-      atcttcggtcaggacgcggcggccga----gagcaggaagtctcag----
A0A3P8U812_BCL2L1-      atttttgggcagaacgccgctgcaga----agcacgaaggtctcgg----
                         * *                  * **                ** *    

A0A3P8S9L3_BCL2-01      tcctgg---ccctccatcaagacggtcttcggtctggcagcactcggggc
A0A3P8RQX7_MCL1-01      ----gaacacactc-------atggcctttgctggatttgctggt----a
A0A3P8RQX7_MCL1-02      ----gaacacactc-------atggcctttgctggatttgctggt----a
A0A3P8RL82_BCL2L10      ----gacttgtccatgaagacagcgctgtt--------tgctgctgcggg
A0A3P8TL99_BCL2L1-      ----ga---gagcttcaagaagtggctgctggtggggatgacggtggtga
A0A3P8TL99_BCL2L1-      ----ga---gagcttcaagaagtggctgctggtggggatgacggtggtga
A0A3P8U812_BCL2L1-      ----ga---tactctgaagagatggctgctagtcggaggggtgctgctaa
                            *                   *              *          

A0A3P8S9L3_BCL2-01      agcgagcctcaccatcggagcgtaccttacacaaaa------gtga
A0A3P8RQX7_MCL1-01      ttggggcaacac--tggccctgctgatcag------------gtga
A0A3P8RQX7_MCL1-02      ttggggcaacac--tggccctgctgatcag------------gtga
A0A3P8RL82_BCL2L10      tgtcggcctcgc--tgggcttac-cttcctcctggtgcg---ctaa
A0A3P8TL99_BCL2L1-      cgggggtggtgg--tgggatcactcatcgcccagaaacgcctgtga
A0A3P8TL99_BCL2L1-      cgggggtggtgg--tgggatcactcatcgcccagaaacgcctgtga
A0A3P8U812_BCL2L1-      tgggagttctgg--ctggtgtgctcattgctaagaaaca---gtga
                             *          *         *                * *

© 1998-2022Legal notice