Dataset for CDS BCL-2-like of organism Rhinopithecus roxellana

[Download (right click)] [Edit] [Sequences] [Repertoires]

13 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A2K6PHF2_BCL2A1-      atgacagactgtg-----------------aatttggatatat-------
A0A2K6PHF2_BCL2A1-      atgacagactgtg-----------------aatttggatatat-------
A0A2K6R2I5_BCL2-02      atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaa
A0A2K6R2I5_BCL2-01      atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaa
A0A2K6QFA2_BCL2L1-      atgtc------------------tcagagcaaccgggagctggtggttga
A0A2K6QFA2_BCL2L1-      atgtc------------------tcagagcaaccgggagctggtggttga
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      atggcgaccccag---cctcggccccagacacacgggctctggtggcaga
A0A2K6RW35_BCL2L2-      atggcgaccccag---cctcggccccagacacacgggctctggtggcaga
A0A2K6RW35_BCL2L2-      atggcgaccccag---cctcggccccagacacacgggctctggtggcaga
A0A2K6R5T5_BCL2L10      atggctgaccc-----gtt----gcgcg---agcgcac------------
A0A2K6PPI3_MCL1-03      atgtttggcttcaaaagaa----acgcggtaatcggac------------
A0A2K6PPI3_MCL1-02      atgtttggcttcaaaagaa----acgcggtaatcggac------------

A0A2K6PHF2_BCL2A1-      ---------ttacaggctagctcaggactatt------------------
A0A2K6PHF2_BCL2A1-      ---------ttacaggctagctcaggactatt------------------
A0A2K6R2I5_BCL2-02      gtacatccactataagctgtcgcagaggggctacgagtggga--------
A0A2K6R2I5_BCL2-01      gtacatccactataagctgtcgcagaggggctacgagtggga--------
A0A2K6QFA2_BCL2L1-      ctttctctcctacaagctttcccagaaaggatacagctggagtcagttta
A0A2K6QFA2_BCL2L1-      ctttctctcctacaagctttcccagaaaggatacagctggagtcagttta
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      ctttttaggttataagctgaggcagaagggttatgtc-------------
A0A2K6RW35_BCL2L2-      ctttttaggttataagctgaggcagaagggttatgtc-------------
A0A2K6RW35_BCL2L2-      ctttttaggttataagctgaggcagaagggttatgtc-------------
A0A2K6R5T5_BCL2L10      ---------cgagcggttgct---ggccgactatctgggg----------
A0A2K6PPI3_MCL1-03      ---------tcaacctctactgtgggggggccggcttggg----------
A0A2K6PPI3_MCL1-02      ---------tcaacctctactgtgggggggccggcttggg----------

A0A2K6PHF2_BCL2A1-      ----tgcagtacgtcctgcagataccacaacctggatcggg---------
A0A2K6PHF2_BCL2A1-      ----tgcagtacgtcctgcagataccacaacctggatcggg---------
A0A2K6R2I5_BCL2-02      ----tgcgggagatgtgggcgccgcgac--ccctgg--ggccgcccc--c
A0A2K6R2I5_BCL2-01      ----tgcgggagatgtgggcgccgcgac--ccctgg--ggccgcccc--c
A0A2K6QFA2_BCL2L1-      gtgatgtggaagagaacaggactgaggc--cccaga--agggactgaatc
A0A2K6QFA2_BCL2L1-      gtgatgtggaagagaacaggactgaggc--cccaga--agggactgaatc
A0A2K6QFA2_BCL2L1-      ---atgtggaagagaacaggactgaggc--cccaga--agggactgaatc
A0A2K6RW35_BCL2L2-      ----tgtggag----------ct--ggc--cctggg--gagggccca---
A0A2K6RW35_BCL2L2-      ----tgtggag----------ct--ggc--cctggg--gagggccca---
A0A2K6RW35_BCL2L2-      ----tgtggag----------ct--ggc--cctggg--gagggccca---
A0A2K6R5T5_BCL2L10      ----tgctgcgcccgggaacccggcacc--cccgagccgaggccgtccac
A0A2K6PPI3_MCL1-03      ----ggccggcagcggcggcgccacccc--tccgg---gagggcg-----
A0A2K6PPI3_MCL1-02      ----ggccggcagcggcggcgccacccc--tccgg---gagggcg-----
                             *  *                  *   *                  

A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6R2I5_BCL2-02      gcaccgggcatc-----------ttctcctcccagcccgggcacacgccc
A0A2K6R2I5_BCL2-01      gcaccgggcatc-----------ttctcctcccagcccgggcacacgccc
A0A2K6QFA2_BCL2L1-      ggagatggagac-----------ccccagtgccatcaatggcaacc----
A0A2K6QFA2_BCL2L1-      ggagatggagac-----------ccccagtgccatcaatggcaacc----
A0A2K6QFA2_BCL2L1-      ggagatggagac-----------ccccagtgccatcaatggcaacc----
A0A2K6RW35_BCL2L2-      gcagct---gac-----------ccgctgcac---------caagc----
A0A2K6RW35_BCL2L2-      gcagct---gac-----------ccgctgcac---------caagc----
A0A2K6RW35_BCL2L2-      gcagct---gac-----------ccgctgcac---------caagc----
A0A2K6R5T5_BCL2L10      gcccgaggccgccgtgctgcgctccgcggc--------------------
A0A2K6PPI3_MCL1-03      gcttttggccac--------------cggc---gccaaggacacaaagcc
A0A2K6PPI3_MCL1-02      gcttttggctacggagaaggaggcctcggcccggcgagagatagggggag

A0A2K6PHF2_BCL2A1-      --------------------tccaagcaaaacgtccagagtgctacaaaa
A0A2K6PHF2_BCL2A1-      --------------------tccaagcaaaacgtccagagtgctacaaaa
A0A2K6R2I5_BCL2-02      catcccgccgcg--------tcccgggacccggtcgccaggacctcgccg
A0A2K6R2I5_BCL2-01      catcccgccgcg--------tcccgggacccggtcgccaggacctcgccg
A0A2K6QFA2_BCL2L1-      ----------ca--------tcctggcacctggtggacagccccgcggtg
A0A2K6QFA2_BCL2L1-      ----------ca--------tcctggcacctggtggacagccccgcggtg
A0A2K6QFA2_BCL2L1-      ----------ca--------tcct--------------------------
A0A2K6RW35_BCL2L2-      ----------ca--------tgcgggca----------------------
A0A2K6RW35_BCL2L2-      ----------ca--------tgcgggca----------------------
A0A2K6RW35_BCL2L2-      ----------ca--------tgcgggca----------------------
A0A2K6R5T5_BCL2L10      --------ggccaggttac-ggcagctccaccggtccttcttctctg---
A0A2K6PPI3_MCL1-03      aatgggcaggtctgg-----ggc-----caccagcaggaaggctctgg-a
A0A2K6PPI3_MCL1-02      gggaggccggcacggtgattggcgaaagcgccggcgcaagccccccggcc

A0A2K6PHF2_BCL2A1-      ggttgcattct---------------------------------------
A0A2K6PHF2_BCL2A1-      ggttgcattct---------------------------------------
A0A2K6R2I5_BCL2-02      ctgccgaccccggctgcccccgccgccgccgcggggcctgcgctcagccc
A0A2K6R2I5_BCL2-01      ctgccgaccccggctgcccccgccgccgccgcggggcctgcgctcagccc
A0A2K6QFA2_BCL2L1-      aatggagccactggccacagcagcagtttggatgcccgggaggtgatccc
A0A2K6QFA2_BCL2L1-      aatggagccactggccacagcagcagtttggatgcccgggaggtgatccc
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K6R5T5_BCL2L10      ---cctacctcggctaccccgggaaccgcgtcgagctggtggcgctgatg
A0A2K6PPI3_MCL1-03      gaccttac----gacgggtgggggatggcgt--------g----------
A0A2K6PPI3_MCL1-02      gccctcacgccagacgcccggagggtcgcgc--------ggccgccgccc

A0A2K6PHF2_BCL2A1-      --------------------cagtccagaaagaagtggaaaagaatctga
A0A2K6PHF2_BCL2A1-      --------------------cagtccagaaagaagtggaaaagaatctga
A0A2K6R2I5_BCL2-02      ggtgccacctgtggtccacctgaccctccgccaggccggtgacgacttct
A0A2K6R2I5_BCL2-01      ggtgccacctgtggtccacctgaccctccgccaggccggtgacgacttct
A0A2K6QFA2_BCL2L1-      catggca---gcagtaaagcaagcgctgagggaggcaggcgacgagtttg
A0A2K6QFA2_BCL2L1-      catggca---gcagtaaagcaagcgctgagggaggcaggcgacgagtttg
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      ----------------------------------gctggagatgagttcg
A0A2K6RW35_BCL2L2-      ----------------------------------gctggagatgagttcg
A0A2K6RW35_BCL2L2-      ----------------------------------gctggagatgagttcg
A0A2K6R5T5_BCL2L10      gcggaggccgtgctctccgacagccccggccccacc-tggggcagggtgg
A0A2K6PPI3_MCL1-03      --------------------------cagcgcaaccacgagacggcttt-
A0A2K6PPI3_MCL1-02      attggcgccgaggtccccgacgtcaccgggacccccgcgaggctgctttt

A0A2K6PHF2_BCL2A1-      agccatgcttggacaatg--------------------ttaatgttgcat
A0A2K6PHF2_BCL2A1-      agccatgcttggacaatg--------------------ttaatgttgcat
A0A2K6R2I5_BCL2-02      cccgccgcta--ccgccgcga-------cttcgccgagatgtccagccag
A0A2K6R2I5_BCL2-01      cccgccgcta--ccgccgcga-------cttcgccgagatgtccagccag
A0A2K6QFA2_BCL2L1-      aactgcggta--ccggcgggc-------gttcagtgacctgacatcccag
A0A2K6QFA2_BCL2L1-      aactgcggta--ccggcgggc-------gttcagtgacctgacatcccag
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      agacccgctt--ccggcgcac-------cttctctgatctggcggctcag
A0A2K6RW35_BCL2L2-      agacccgctt--ccggcgcac-------cttctctgatctggcggctcag
A0A2K6RW35_BCL2L2-      agacccgctt--ccggcgcac-------cttctctgatctggcggctcag
A0A2K6R5T5_BCL2L10      tgtcgctggtgaccttcgcggggacgctgctggagag---------agag
A0A2K6PPI3_MCL1-03      ------------ccaaggcatg------cttcggaaactggacatcaaaa
A0A2K6PPI3_MCL1-02      ctttgcgcccacccgccgcgcggcgcctcttgaggagatggaagccccgg

A0A2K6PHF2_BCL2A1-      ccatagacactgccag------------aacactattc------------
A0A2K6PHF2_BCL2A1-      ccatagacactgccag------------aacactattc------------
A0A2K6R2I5_BCL2-02      ctgcacctgacgcccttcaccgcgcggggacgcttt--------------
A0A2K6R2I5_BCL2-01      ctgcacctgacgcccttcaccgcgcggggacgcttt--------------
A0A2K6QFA2_BCL2L1-      ctccacatcaccccagggacagcatatcagagcttt--------------
A0A2K6QFA2_BCL2L1-      ctccacatcaccccagggacagcatatcagagcttt--------------
A0A2K6QFA2_BCL2L1-      ---------------gggacagcatatcagagcttt--------------
A0A2K6RW35_BCL2L2-      ctgcatgtgaccccaggctcagcgcagcaacgcttc--------------
A0A2K6RW35_BCL2L2-      ctgcatgtgaccccaggctcagcgcagcaacgcttc--------------
A0A2K6RW35_BCL2L2-      ctgcatgtgaccccaggctcagcgcagcaacgcttc--------------
A0A2K6R5T5_BCL2L10      ccgctggtgac---------------------------------------
A0A2K6PPI3_MCL1-03      acgaagacgatgtca-----------------------------------
A0A2K6PPI3_MCL1-02      ccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccg

A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6R2I5_BCL2-02      --------------------------------------------------
A0A2K6R2I5_BCL2-01      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K6R5T5_BCL2L10      --------------------------------------------------
A0A2K6PPI3_MCL1-03      --------------------------------------------------
A0A2K6PPI3_MCL1-02      gagcctctcgggaagcggccggctgtcctgcccctgctggagttggtcgg

A0A2K6PHF2_BCL2A1-      --aatcaagtgatg-----------gaaaagg-----agtttgaagatgg
A0A2K6PHF2_BCL2A1-      --aatcaagtgatg-----------gaaaagg-----agtttgaagatgg
A0A2K6R2I5_BCL2-02      --gccacggtggtg-----------gaggagc-----tcttcagggacgg
A0A2K6R2I5_BCL2-01      --gccacggtggtg-----------gaggagc-----tcttcagggacgg
A0A2K6QFA2_BCL2L1-      --gaacaggtagtg-----------aatgaac-----tcttccgggatgg
A0A2K6QFA2_BCL2L1-      --gaacaggtagtg-----------aatgaac-----tcttccgggatgg
A0A2K6QFA2_BCL2L1-      --gaacaggtagtg-----------aatgaac-----tcttccgggatgg
A0A2K6RW35_BCL2L2-      --acccaggtctct-----------gatgaac-----ttttccaaggggg
A0A2K6RW35_BCL2L2-      --acccaggtctct-----------gatgaac-----ttttccaaggggg
A0A2K6RW35_BCL2L2-      --acccaggtctct-----------gatgaac-----ttttccaaggggg
A0A2K6R5T5_BCL2L10      --agcctggtg--------------gaagaagcggagcttccagccgcgg
A0A2K6PPI3_MCL1-03      --aatctt----tatctcgagt---gatggtcca-tgttttcagcgacgg
A0A2K6PPI3_MCL1-02      ggaatctggtaatagctccagtacggatgggtcactaccctcgacgccgc
                                                  *                     * 

A0A2K6PHF2_BCL2A1-      ca-tcattaactggggaagaa-------ttgt------------------
A0A2K6PHF2_BCL2A1-      ca-tcattaactggggaagaa-------ttgt------------------
A0A2K6R2I5_BCL2-02      gg----tgaactgggggagga-------ttgt------------------
A0A2K6R2I5_BCL2-01      gg----tgaactgggggagga-------ttgt------------------
A0A2K6QFA2_BCL2L1-      gg----taaactggggtcgca-------ttgt------------------
A0A2K6QFA2_BCL2L1-      gg----taaactggggtcgca-------ttgt------------------
A0A2K6QFA2_BCL2L1-      gg----taaactggggtcgca-------ttgt------------------
A0A2K6RW35_BCL2L2-      cc----ccaactggggccgcc-------ttgt------------------
A0A2K6RW35_BCL2L2-      cc----ccaactggggccgcc-------ttgt------------------
A0A2K6RW35_BCL2L2-      cc----ccaactggggccgcc-------ttgt------------------
A0A2K6R5T5_BCL2L10      ct-----gaa--ggagcaggagggcgaggtcgcccgggact--------g
A0A2K6PPI3_MCL1-03      cg-taacaaactggggcagga-------ttgt---gactctcatt-----
A0A2K6PPI3_MCL1-02      cgccagcaga--ggaggaggaggacgagttgtaccggcagtcactggaaa
                                 *  ** *  *          *                    

A0A2K6PHF2_BCL2A1-      --aaccatatttgcatttg--------------------aaggtattctc
A0A2K6PHF2_BCL2A1-      --aaccatatttgcatttg--------------------aaggtattctc
A0A2K6R2I5_BCL2-02      --ggccttctttgagttcg------------------gtggggtcatgtg
A0A2K6R2I5_BCL2-01      --ggccttctttgagttcg------------------gtggggtcatgtg
A0A2K6QFA2_BCL2L1-      --ggcctttttctccttcg------------------gcggggcactgtg
A0A2K6QFA2_BCL2L1-      --ggcctttttctccttcg------------------gcggggcactgtg
A0A2K6QFA2_BCL2L1-      --ggcctttttctccttcg------------------gcggggcactgtg
A0A2K6RW35_BCL2L2-      --agccttctttgtctttg------------------gggctgcactgtg
A0A2K6RW35_BCL2L2-      --agccttctttgtctttg------------------gggctgcactgtg
A0A2K6RW35_BCL2L2-      --agccttctttgtctttg------------------gggctgcactgtg
A0A2K6R5T5_BCL2L10      ccagcgcctggtggccttgctgagctcgcggctcacggggcagcaccgcg
A0A2K6PPI3_MCL1-03      ---tcttttggtgcctttg-----------------tggctaa----aca
A0A2K6PPI3_MCL1-02      ttatctctcggtaccttcg-----------------ggagcag----gcc
                            *           * *                               

A0A2K6PHF2_BCL2A1-      atcaa------------gaaacttctacgacagcaaattgccccggatgt
A0A2K6PHF2_BCL2A1-      atcaa------------gaaacttctacgacagcaaattgccccggatgt
A0A2K6R2I5_BCL2-02      tgtgg------------agagcgtcaaccggg------------agatgt
A0A2K6R2I5_BCL2-01      tgtgg------------agagcgtcaaccggg------------agatgt
A0A2K6QFA2_BCL2L1-      cgtgg------------aaagcgtagacaagg------------agatgc
A0A2K6QFA2_BCL2L1-      cgtgg------------aaagcgtagacaagg------------agatgc
A0A2K6QFA2_BCL2L1-      cgtgg------------aaagcgtagacaagg------------agatgc
A0A2K6RW35_BCL2L2-      tgctg------------agagtgtcaacaagg------------agatgg
A0A2K6RW35_BCL2L2-      tgctg------------agagtgtcaacaagg------------agatgg
A0A2K6RW35_BCL2L2-      tgctg------------agagtgtcaacaagg------------agatgg
A0A2K6R5T5_BCL2L10      cctggcttcagg--ctcagggcggctgggtga------------gcacgc
A0A2K6PPI3_MCL1-03      cttg-----aagaccataaa-ccaagaaagtt------------gcatcg
A0A2K6PPI3_MCL1-02      accggcgccaaggacacaaagccaatgggcag------------gtctgg

A0A2K6PHF2_BCL2A1-      ggatacttataaggagattt-----cgtattttgttgctgagttcataat
A0A2K6PHF2_BCL2A1-      ggatacttataaggagattt-----cgtattttgttgctgagttcataat
A0A2K6R2I5_BCL2-02      cgcccctggtggacaacatc----gccctgtggatgactgagtacctgaa
A0A2K6R2I5_BCL2-01      cgcccctggtggacaacatc----gccctgtggatgactgagtacctgaa
A0A2K6QFA2_BCL2L1-      aggtattggtgagtcggatc----gcagcttggatggccacttatctgaa
A0A2K6QFA2_BCL2L1-      aggtattggtgagtcggatc----gcagcttggatggccacttatctgaa
A0A2K6QFA2_BCL2L1-      aggtattggtgagtcggatc----gcagcttggatggccacttatctgaa
A0A2K6RW35_BCL2L2-      aaccactggtgggacaagtg----caggagtggatggtggcctacctgga
A0A2K6RW35_BCL2L2-      aaccactggtgggacaagtg----caggagtggatggtggcctacctgga
A0A2K6RW35_BCL2L2-      aaccactggtgggacaagtg----caggagtggatggtggcctacctgga
A0A2K6R5T5_BCL2L10      ggcggacaccgggacg------------------------cggggcggga
A0A2K6PPI3_MCL1-03      aaccattagcagaaagtatc-acagacgttctcgtaaggacaaaacggga
A0A2K6PPI3_MCL1-02      ggccaccagcaggaaggctctggagacctt------acgacgggtggggg

A0A2K6PHF2_BCL2A1-      gaataacacaggagaatggataaggcaaaacggaggct-gggaaaatggc
A0A2K6PHF2_BCL2A1-      gaataacacaggagaatggataaggcaaaacggaggctgggggaaatggc
A0A2K6R2I5_BCL2-02      ccggcacctgcacacttggatccaggataacggaggctg--------gcg
A0A2K6R2I5_BCL2-01      ccggcacctgcacacttggatccaggataacggaggctg--------gga
A0A2K6QFA2_BCL2L1-      tgaccacctagagccttggatccaggagaacggcggctg--------gga
A0A2K6QFA2_BCL2L1-      tgaccacctagagccttggatccaggagaacggcggctg--------gga
A0A2K6QFA2_BCL2L1-      tgaccacctagagccttggatccaggagaacggcggctg--------gga
A0A2K6RW35_BCL2L2-      gacgcggctggctgactggatccacagcagtgggggctg--------ggc
A0A2K6RW35_BCL2L2-      gacgcggctggctgactggatccacagcagtgggggctg--------ggc
A0A2K6RW35_BCL2L2-      gacgcggctggctgactggatccacagcagtgggggctg--------gga
A0A2K6R5T5_BCL2L10      cgggcatccggga---agcgcccacga-------ggccg----gcacgga
A0A2K6PPI3_MCL1-03      ctggc---tag-----ttaaacaaaga-------ggctg--------gga
A0A2K6PPI3_MCL1-02      atggcgtgcag-----cgcaaccacga-------gacggctttccaagga
                                                          * *          *  

A0A2K6PHF2_BCL2A1-      tttgtaaagaagtttgaacctaaatctggctggatgacttttctagaagt
A0A2K6PHF2_BCL2A1-      -------acaatcacatgcctatg-ctagtagagtcagtggcccacaaga
A0A2K6R2I5_BCL2-02      t------ac---------aatgt---------------------------
A0A2K6R2I5_BCL2-01      t------gcctttgtggaactgta--cggccc------------------
A0A2K6QFA2_BCL2L1-      c------acttttgtggaactcta--tgggaacaatgc------agcagc
A0A2K6QFA2_BCL2L1-      c------acttttgtggaactcta--tgggaacaatgc------agcagc
A0A2K6QFA2_BCL2L1-      c------acttttgtggaactcta--tgggaacaatgc------agcagc
A0A2K6RW35_BCL2L2-      g------gagttcacagctctata--cggggacggggccctggaggaggc
A0A2K6RW35_BCL2L2-      g------gagttcacagctctata--cggggacggggccctggaggaggc
A0A2K6RW35_BCL2L2-      gctggaagctatcaaagctcgagt--cagggagatgga---ggaagaagc
A0A2K6R5T5_BCL2L10      t------ggcttttgtcacttctt--c-------aggaccccctttccgc
A0A2K6PPI3_MCL1-03      t------gggtttgtggagttctt--ccatgtagagga---cctagaagg
A0A2K6PPI3_MCL1-02      t------gggtttgtggagttctt--ccatgtagagga---cctagaagg

A0A2K6PHF2_BCL2A1-      ta-----------------------------caggaaagatctgtgaaat
A0A2K6PHF2_BCL2A1-      ag-----------------------------aagaaaatggctttgtaa-
A0A2K6R2I5_BCL2-02      ---------------------------------gcacgtggt--------
A0A2K6R2I5_BCL2-01      -------------------------------cagcatgcggcctctgttt
A0A2K6QFA2_BCL2L1-      cgagagccgaaagggcc--------------aggagcgcttcaaccgctg
A0A2K6QFA2_BCL2L1-      cgagagccgaaagggcc--------------aggagcgcttcaaccgctg
A0A2K6QFA2_BCL2L1-      cgagagccgaaagggcc--------------aggagcgcttcaaccgctg
A0A2K6RW35_BCL2L2-      gcggcgtctgcgggag---------------gggaactgggcatcagtga
A0A2K6RW35_BCL2L2-      gcggcgtctgcgggag---------------gggaactgggcatcagtga
A0A2K6RW35_BCL2L2-      tgagaagctaaaggagctacagaacgaggtagagaagcagatgaatatga
A0A2K6R5T5_BCL2L10      tggctttttg---------------------gagaaaactgctgatccag
A0A2K6PPI3_MCL1-03      tggcatc-------------------------agaaatgtgctg---ctg
A0A2K6PPI3_MCL1-02      tggcatc-------------------------agaaatgtgctg---ctg

A0A2K6PHF2_BCL2A1-      gctat--------------------ctctcctgaagcaatactgt-----
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6R2I5_BCL2-02      ----------------------------------gccgcttcag------
A0A2K6R2I5_BCL2-01      gattt-----------------------ctcctggctgtctctgaa----
A0A2K6QFA2_BCL2L1-      g----------------------------ttcctgacgggcatgac----
A0A2K6QFA2_BCL2L1-      g----------------------------ttcctgacgggcatgac----
A0A2K6QFA2_BCL2L1-      g----------------------------ttcctgacgggcatgac----
A0A2K6RW35_BCL2L2-      g---------------------------------gacagtgctgac----
A0A2K6RW35_BCL2L2-      g---------------------------------gacagtgctgac----
A0A2K6RW35_BCL2L2-      gtcca-----------------------cctccaggcaatgctggcccag
A0A2K6R5T5_BCL2L10      gctttcctggcatgcttgttaacaacagccttcggttacctctgga----
A0A2K6PPI3_MCL1-03      gcttt-------------------------tgcaggtgttgctgg-----
A0A2K6PPI3_MCL1-02      gcttt-------------------------tgcaggtgttgctgg-----

A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6R2I5_BCL2-02      --------------------------------------------------
A0A2K6R2I5_BCL2-01      -------gactctgctcagtttggccctggtgggagcttgcatcaccctg
A0A2K6QFA2_BCL2L1-      -------------------------tgtggccggcg--------------
A0A2K6QFA2_BCL2L1-      -------------------------tgtggccggcg--------------
A0A2K6QFA2_BCL2L1-      -------------------------tgtggccggcg--------------
A0A2K6RW35_BCL2L2-      -------------------------gggggccg-----------------
A0A2K6RW35_BCL2L2-      -------------------------gggggccg-----------------
A0A2K6RW35_BCL2L2-      tgatcatgtccattgaggagaagatggaggctgatgcccgttccatctat
A0A2K6R5T5_BCL2L10      ---------------cacgattattatgagt-----tttaaaatttttaa
A0A2K6PPI3_MCL1-03      ----------------------agtaggagctg--gtttggcatatctaa
A0A2K6PPI3_MCL1-02      ----------------------agtaggagctg--gtttggcatatctaa

A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6R2I5_BCL2-02      -----------gggatgtgat-----------------------------
A0A2K6R2I5_BCL2-01      ggtgcctatctgggccacaag-----------------------------
A0A2K6QFA2_BCL2L1-      --tggttctgctgggctcact-----------------------------
A0A2K6QFA2_BCL2L1-      --tggttctgctgggctcact-----------------------------
A0A2K6QFA2_BCL2L1-      --tggttctgctgggctcact-----------------------------
A0A2K6RW35_BCL2L2-      --tggcactgggggccctggt-----------------------------
A0A2K6RW35_BCL2L2-      --tggcactgggggccctggt-----------------------------
A0A2K6RW35_BCL2L2-      gttggcaatgtggactatggtgcaacagcagaagagctggaagctcactt
A0A2K6R5T5_BCL2L10      cccacttctacctgcccaactg----------------------------
A0A2K6PPI3_MCL1-03      taagat------ag------------------------------------
A0A2K6PPI3_MCL1-02      taagat------agccttactg----------------------------

A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6R2I5_BCL2-02      --------------------------------------------------
A0A2K6R2I5_BCL2-01      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      -------------------------------------------aactgta
A0A2K6RW35_BCL2L2-      -------------------------------------------aactgta
A0A2K6RW35_BCL2L2-      tcatggctgtggatcagtcaaccgtgttaccatactctgtgacaaattta
A0A2K6R5T5_BCL2L10      --------------------------------------------------
A0A2K6PPI3_MCL1-03      --------------------------------------------------
A0A2K6PPI3_MCL1-02      --------------------------------------------------

A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6R2I5_BCL2-02      --------------------------------------------------
A0A2K6R2I5_BCL2-01      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      ggggcctt------------------------------------------
A0A2K6RW35_BCL2L2-      ggggcctt------------------------------------------
A0A2K6RW35_BCL2L2-      gtggccatcccaaagggtttgcgtatatagagttctcagacaaagagtca
A0A2K6R5T5_BCL2L10      --------------------------------------------------
A0A2K6PPI3_MCL1-03      --------------------------------------------------
A0A2K6PPI3_MCL1-02      --------------------------------------------------

A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6R2I5_BCL2-02      --------------------------------------------------
A0A2K6R2I5_BCL2-01      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      gtgaggacttccttggccttagatgagtccctatttagaggaaggcaaat
A0A2K6R5T5_BCL2L10      --------------------------------------------------
A0A2K6PPI3_MCL1-03      --------------------------------------------------
A0A2K6PPI3_MCL1-02      --------------------------------------------------

A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6R2I5_BCL2-02      --------------------------------------------------
A0A2K6R2I5_BCL2-01      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      caaggtgatcccaaaacgaaccaacagaccaggcatcagcacaacagacc
A0A2K6R5T5_BCL2L10      --------------------------------------------------
A0A2K6PPI3_MCL1-03      --------------------------------------------------
A0A2K6PPI3_MCL1-02      --------------------------------------------------

A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6R2I5_BCL2-02      --------------------------------------------------
A0A2K6R2I5_BCL2-01      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      ggggttttccacgagcccgctaccgcgcccggaccaccaactacaacagt
A0A2K6R5T5_BCL2L10      --------------------------------------------------
A0A2K6PPI3_MCL1-03      --------------------------------------------------
A0A2K6PPI3_MCL1-02      --------------------------------------------------

A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6R2I5_BCL2-02      --------------------------------------------------
A0A2K6R2I5_BCL2-01      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      -----------------------cttcagtcggaaa--------------
A0A2K6QFA2_BCL2L1-      -----------------------cttcagtcggaaa--------------
A0A2K6QFA2_BCL2L1-      -----------------------cttcagtcggaaa--------------
A0A2K6RW35_BCL2L2-      -----------------------ttttgctagcaag--------------
A0A2K6RW35_BCL2L2-      -----------------------ttttgctagcaag--------------
A0A2K6RW35_BCL2L2-      tcccgctctcgcttctacagtggttttaacagcaggccccggggtcgcgt
A0A2K6R5T5_BCL2L10      --------------------------------------------------
A0A2K6PPI3_MCL1-03      --------------------------------------------------
A0A2K6PPI3_MCL1-02      --------------------------------------------------

A0A2K6PHF2_BCL2A1-      -------------tga
A0A2K6PHF2_BCL2A1-      ----------------
A0A2K6R2I5_BCL2-02      -------------tga
A0A2K6R2I5_BCL2-01      -------------tga
A0A2K6QFA2_BCL2L1-      -------------tga
A0A2K6QFA2_BCL2L1-      -------------tga
A0A2K6QFA2_BCL2L1-      -------------tga
A0A2K6RW35_BCL2L2-      -------------tga
A0A2K6RW35_BCL2L2-      -------------tga
A0A2K6RW35_BCL2L2-      ctacaggtcaggatag
A0A2K6R5T5_BCL2L10      -------------tga
A0A2K6PPI3_MCL1-03      ----------------
A0A2K6PPI3_MCL1-02      -------------taa

© 1998-2020Legal notice