Dataset for CDS BCL-2-like of organism Rhinopithecus roxellana

[Download (right click)] [Edit] [Sequences] [Repertoires]

15 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K6PHF2_BCL2A1-      atgacagactgtg----------------------aatttggatatattt
A0A2K6PHF2_BCL2A1-      atgacagactgtg----------------------aatttggatatattt
A0A2K6R5T5_BCL2L10      atggctgaccc-----gttgcgcg---agcgcaccgagcggttgct---g
A0A2K6PPI3_MCL1-02      atgtttggcttcaaaagaaacgcggtaatcggactcaacctctactgtgg
A0A2K6PPI3_MCL1-01      atgtttggcttcaaaagaaacgcggtaatcggactcaacctctactgtgg
A0A2K6PPI3_MCL1-03      atgtttggcttcaaaagaaacgcggtaatcggactcaacctctactgtgg
A0A2K6R2I5_BCL2-01      atggcgcacgctgggagaacaggg-----tacgataaccgggagatagtg
A0A2K6R2I5_BCL2-02      atggcgcacgctgggagaacaggg-----tacgataaccgggagatagtg
A0A2K6QFA2_BCL2L1-      ------------------atgtct-----cagagcaaccgggagctggtg
A0A2K6QFA2_BCL2L1-      ------------------atgtct-----cagagcaaccgggagctggtg
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      atggcgaccccag---cctcggcc-----ccagacacacgggctctggtg
A0A2K6RW35_BCL2L2-      atggcgaccccag---cctcggcc-----ccagacacacgggctctggtg
A0A2K6RW35_BCL2L2-      atggcgaccccag---cctcggcc-----ccagacacacgggctctggtg
A0A2K6RW35_BCL2L2-      --------------------------------------------------
                                                                          

A0A2K6PHF2_BCL2A1-      acaggctagctca-------------------------------------
A0A2K6PHF2_BCL2A1-      acaggctagctca-------------------------------------
A0A2K6R5T5_BCL2L10      gccgactatctggggtgctgcgcccgggaacccggcacccccgagccgag
A0A2K6PPI3_MCL1-02      gggggccggcttgggggccggcagcggcggcgccacccctccgggagggc
A0A2K6PPI3_MCL1-01      gggggccggcttgggggccggcagcggcggcgccacccctccgggagggc
A0A2K6PPI3_MCL1-03      gggggccggcttgggggccggcagcggcggcgccacccctccgggagggc
A0A2K6R2I5_BCL2-01      atgaagtacatccactataagctgtcgcagaggggctacgagtgggatgc
A0A2K6R2I5_BCL2-02      atgaagtacatccactataagctgtcgcagaggggctacgagtgggatgc
A0A2K6QFA2_BCL2L1-      gttgactttctctcctacaagctttcccagaaaggatacagctggagtca
A0A2K6QFA2_BCL2L1-      gttgactttctctcctacaagctttcccagaaaggatacagctggagtca
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      gcagactttttaggttataagctgaggcagaagggttatgtc--------
A0A2K6RW35_BCL2L2-      gcagactttttaggttataagctgaggcagaagggttatgtc--------
A0A2K6RW35_BCL2L2-      gcagactttttaggttataagctgaggcagaagggttatgtc--------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
                                                                          

A0A2K6PHF2_BCL2A1-      -------------ggactatttgcagtacgtcctgcagataccacaacct
A0A2K6PHF2_BCL2A1-      -------------ggactatttgcagtacgtcctgcagataccacaacct
A0A2K6R5T5_BCL2L10      gccgtccacgcccgaggccgccgtgctgcgctccgcggcggccagg----
A0A2K6PPI3_MCL1-02      ggcttttggctacggagaaggaggcctcggcccggcgagagataggggga
A0A2K6PPI3_MCL1-01      ggcttttggctacggagaaggaggcctcggcccggcgagagataggggga
A0A2K6PPI3_MCL1-03      ggctttt-------------------------------------------
A0A2K6R2I5_BCL2-01      ggga---------gatgtgggcgccgcgacccctggggccgcccccgcac
A0A2K6R2I5_BCL2-02      ggga---------gatgtgggcgccgcgacccctggggccgcccccgcac
A0A2K6QFA2_BCL2L1-      gttt---------agtgatgtggaagagaacaggactgaggccccagaag
A0A2K6QFA2_BCL2L1-      gttt---------agtgatgtggaagagaacaggactgaggccccagaag
A0A2K6QFA2_BCL2L1-      -----------------atgtggaagagaacaggactgaggccccagaag
A0A2K6RW35_BCL2L2-      ------------------tgtggagctggccctggggagggccc------
A0A2K6RW35_BCL2L2-      ------------------tgtggagctggccctggggagggccc------
A0A2K6RW35_BCL2L2-      ------------------tgtggagctggccctggggagggccc------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
                                                                          

A0A2K6PHF2_BCL2A1-      gga------------tcgggtccaagcaaaacgtccagagtgcta-----
A0A2K6PHF2_BCL2A1-      gga------------tcgggtccaagcaaaacgtccagagtgcta-----
A0A2K6R5T5_BCL2L10      --------------------ttacggcagctccaccg---gtccttcttc
A0A2K6PPI3_MCL1-02      ggggaggccggcacggtgattggcgaaagcgccggcgcaagccccccggc
A0A2K6PPI3_MCL1-01      ggggaggccggcacggtgattggcgaaagcgccggcgcaagccccccggc
A0A2K6PPI3_MCL1-03      --------------------------------------------------
A0A2K6R2I5_BCL2-01      cgggcatcttctcctcccagcccgggcacacgccccatcccgccg-----
A0A2K6R2I5_BCL2-02      cgggcatcttctcctcccagcccgggcacacgccccatcccgccg-----
A0A2K6QFA2_BCL2L1-      gga------------ctgaatcggagatggagacccccagtgccatcaat
A0A2K6QFA2_BCL2L1-      gga------------ctgaatcggagatggagacccccagtgccatcaat
A0A2K6QFA2_BCL2L1-      gga------------ctgaatcggagatggagacccccagtgccatcaat
A0A2K6RW35_BCL2L2-      ------------------------agcagctgacccgctgcacca-----
A0A2K6RW35_BCL2L2-      ------------------------agcagctgacccgctgcacca-----
A0A2K6RW35_BCL2L2-      ------------------------agcagctgacccgctgcacca-----
A0A2K6RW35_BCL2L2-      --------------------------------------------------
                                                                          

A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6R5T5_BCL2L10      tctgcctacctcggctaccccgggaaccgcgtcgagctggtggcgctgat
A0A2K6PPI3_MCL1-02      cgccctcacgccagacgcccggagggtcgcgc--------ggccgccgcc
A0A2K6PPI3_MCL1-01      cgccctcacgccagacgcccggagggtcgcgc--------ggccgccgcc
A0A2K6PPI3_MCL1-03      --------------------------------------------------
A0A2K6R2I5_BCL2-01      -------cgtcccgggacccggtcgccaggacctcgccgctgccgacccc
A0A2K6R2I5_BCL2-02      -------cgtcccgggacccggtcgccaggacctcgccgctgccgacccc
A0A2K6QFA2_BCL2L1-      ggcaacccatcctggcacctggtggacagccccgcggtgaatggagccac
A0A2K6QFA2_BCL2L1-      ggcaacccatcctggcacctggtggacagccccgcggtgaatggagccac
A0A2K6QFA2_BCL2L1-      ggcaacccatcct-------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
                                                                          

A0A2K6PHF2_BCL2A1-      -------------------------------------------caaaagg
A0A2K6PHF2_BCL2A1-      -------------------------------------------caaaagg
A0A2K6R5T5_BCL2L10      ggcggaggccgtgctctccgacagcccc-ggccccacctggggcagggtg
A0A2K6PPI3_MCL1-02      cattggcgccgaggtccccgacgtcaccgggacccccgcgaggctgcttt
A0A2K6PPI3_MCL1-01      cattggcgccgaggtccccgacgtcaccgggacccccgcgaggctgcttt
A0A2K6PPI3_MCL1-03      --------------------------------------------------
A0A2K6R2I5_BCL2-01      ggctgcccccgccgccgccgcggggcctgcgctcagcccggtgccacctg
A0A2K6R2I5_BCL2-02      ggctgcccccgccgccgccgcggggcctgcgctcagcccggtgccacctg
A0A2K6QFA2_BCL2L1-      tggccacagcagcagtttggatgcccgggaggtgatccccatggca---g
A0A2K6QFA2_BCL2L1-      tggccacagcagcagtttggatgcccgggaggtgatccccatggca---g
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
                                                                          

A0A2K6PHF2_BCL2A1-      ttgcattctcagtccagaaagaagtg------------------------
A0A2K6PHF2_BCL2A1-      ttgcattctcagtccagaaagaagtg------------------------
A0A2K6R5T5_BCL2L10      gtgtcgctggtgaccttcgcggggacgctgctggagagag---------a
A0A2K6PPI3_MCL1-02      tctttgcgcccacccgccgcgcggcgcctcttgaggagatggaagccccg
A0A2K6PPI3_MCL1-01      tctttgcgcccacccgccgcgcggcgcctcttgaggagatggaagccccg
A0A2K6PPI3_MCL1-03      --------------------------------------------------
A0A2K6R2I5_BCL2-01      tggtccacctgaccctccgccaggcc------------------------
A0A2K6R2I5_BCL2-02      tggtccacctgaccctccgccaggcc------------------------
A0A2K6QFA2_BCL2L1-      cagtaaagcaagcgctgagggaggca------------------------
A0A2K6QFA2_BCL2L1-      cagtaaagcaagcgctgagggaggca------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      ----------agccatgcgggcagct------------------------
A0A2K6RW35_BCL2L2-      ----------agccatgcgggcagct------------------------
A0A2K6RW35_BCL2L2-      ----------agccatgcgggcagct------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
                                                                          

A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6R5T5_BCL2L10      gccgctggtgacagcctggtggaagaagcggagct---------------
A0A2K6PPI3_MCL1-02      gccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagcc
A0A2K6PPI3_MCL1-01      gccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagcc
A0A2K6PPI3_MCL1-03      --------------------------------------------------
A0A2K6R2I5_BCL2-01      --------------------------------------------------
A0A2K6R2I5_BCL2-02      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
                                                                          

A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6R5T5_BCL2L10      --------------------------tccagccgcggctg----------
A0A2K6PPI3_MCL1-02      ggagcctctcgggaagcggccggctgtcctgcccctgctggagttggtcg
A0A2K6PPI3_MCL1-01      ggagcctctcgggaagcggccggctgtcctgcccctgctggagttggtcg
A0A2K6PPI3_MCL1-03      --------------------------------------------------
A0A2K6R2I5_BCL2-01      --------------------------------------------------
A0A2K6R2I5_BCL2-02      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
                                                                          

A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6R5T5_BCL2L10      --------------------------------------------------
A0A2K6PPI3_MCL1-02      gggaatctggtaatagctccagtacggatgggtcactaccctcgacgccg
A0A2K6PPI3_MCL1-01      gggaatctggtaatagctccagtacggatgggtcactaccctcgacgccg
A0A2K6PPI3_MCL1-03      --------------------------------------------------
A0A2K6R2I5_BCL2-01      --------------------------------------------------
A0A2K6R2I5_BCL2-02      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
                                                                          

A0A2K6PHF2_BCL2A1-      -------gaaaagaatctgaagccatgcttggacaa--------------
A0A2K6PHF2_BCL2A1-      -------gaaaagaatctgaagccatgcttggacaa--------------
A0A2K6R5T5_BCL2L10      ---------aaggagcaggagggcgaggtcgcccgg--------------
A0A2K6PPI3_MCL1-02      ccgccagcagaggaggaggaggacgagttgtaccggcagtcactggaaat
A0A2K6PPI3_MCL1-01      ccgccagcagaggaggaggaggacgagttgtaccggcagtcactggaaat
A0A2K6PPI3_MCL1-03      --------------------------------------------------
A0A2K6R2I5_BCL2-01      ------------------ggtgacgacttctcccgc--------------
A0A2K6R2I5_BCL2-02      ------------------ggtgacgacttctcccgc--------------
A0A2K6QFA2_BCL2L1-      ------------------ggcgacgagtttgaactg--------------
A0A2K6QFA2_BCL2L1-      ------------------ggcgacgagtttgaactg--------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      ------------------ggagatgagttcgagacc--------------
A0A2K6RW35_BCL2L2-      ------------------ggagatgagttcgagacc--------------
A0A2K6RW35_BCL2L2-      ------------------ggagatgagttcgagacc--------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
                                                                          

A0A2K6PHF2_BCL2A1-      ------------------------tgttaatgttgc--------------
A0A2K6PHF2_BCL2A1-      ------------------------tgttaatgttgc--------------
A0A2K6R5T5_BCL2L10      ------------------------gactgccagcgcctggtggccttgct
A0A2K6PPI3_MCL1-02      tatctctcggtaccttcgggagcaggccaccggcgccaaggacacaaagc
A0A2K6PPI3_MCL1-01      tatctctcggtaccttcgggagcaggccaccggcgccaaggacacaaagc
A0A2K6PPI3_MCL1-03      ------------------------ggccaccggcgccaaggacacaaagc
A0A2K6R2I5_BCL2-01      ------------------------cgctaccgccgc-----gacttcgcc
A0A2K6R2I5_BCL2-02      ------------------------cgctaccgccgc-----gacttcgcc
A0A2K6QFA2_BCL2L1-      ------------------------cggtaccggcgg-----gcgttcagt
A0A2K6QFA2_BCL2L1-      ------------------------cggtaccggcgg-----gcgttcagt
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      ------------------------cgcttccggcgc-----accttctct
A0A2K6RW35_BCL2L2-      ------------------------cgcttccggcgc-----accttctct
A0A2K6RW35_BCL2L2-      ------------------------cgcttccggcgc-----accttctct
A0A2K6RW35_BCL2L2-      --------------------------------------------------
                                                                          

A0A2K6PHF2_BCL2A1-      -----------------------atccatagacactgccagaacactatt
A0A2K6PHF2_BCL2A1-      -----------------------atccatagacactgccagaacactatt
A0A2K6R5T5_BCL2L10      gagctcgcggctcacgggg---cagcaccgcgcctggcttcagg---ctc
A0A2K6PPI3_MCL1-02      caatgggcaggtctggggc---caccagcaggaa-ggctctggagacctt
A0A2K6PPI3_MCL1-01      caatgggcaggtctggggc---caccagcaggaa-ggctctggagacctt
A0A2K6PPI3_MCL1-03      caatgggcaggtctggggc---caccagcaggaa-ggctctggagacctt
A0A2K6R2I5_BCL2-01      gagatgtccagccagctgcacctgacgcccttcaccgcgcggggacgctt
A0A2K6R2I5_BCL2-02      gagatgtccagccagctgcacctgacgcccttcaccgcgcggggacgctt
A0A2K6QFA2_BCL2L1-      gacctgacatcccagctccacatcaccccagggacagcatatcagagctt
A0A2K6QFA2_BCL2L1-      gacctgacatcccagctccacatcaccccagggacagcatatcagagctt
A0A2K6QFA2_BCL2L1-      ------------------------------gggacagcatatcagagctt
A0A2K6RW35_BCL2L2-      gatctggcggctcagctgcatgtgaccccaggctcagcgcagcaacgctt
A0A2K6RW35_BCL2L2-      gatctggcggctcagctgcatgtgaccccaggctcagcgcagcaacgctt
A0A2K6RW35_BCL2L2-      gatctggcggctcagctgcatgtgaccccaggctcagcgcagcaacgctt
A0A2K6RW35_BCL2L2-      --------------------------------------------------
                                                                          

A0A2K6PHF2_BCL2A1-      caatcaagtgatgga--------aaaggagtttgaagatggcat------
A0A2K6PHF2_BCL2A1-      caatcaagtgatgga--------aaaggagtttgaagatggcat------
A0A2K6R5T5_BCL2L10      agggcggctgggtga--gcacgcggcg-gacaccgggacg----------
A0A2K6PPI3_MCL1-02      acgacgggtgggggatggcgtgcagcgcaaccacgagacggctttccaa-
A0A2K6PPI3_MCL1-01      acgacgggtgggggatggcgtgcagcgcaaccacgagacggctttccaag
A0A2K6PPI3_MCL1-03      acgacgggtgggggatggcgtgcagcgcaaccacgagacggctttccaag
A0A2K6R2I5_BCL2-01      tgccacggtggtgga--------ggagctcttcagggacggggt------
A0A2K6R2I5_BCL2-02      tgccacggtggtgga--------ggagctcttcagggacggggt------
A0A2K6QFA2_BCL2L1-      tgaacaggtagtgaa--------tgaactcttccgggatggggt------
A0A2K6QFA2_BCL2L1-      tgaacaggtagtgaa--------tgaactcttccgggatggggt------
A0A2K6QFA2_BCL2L1-      tgaacaggtagtgaa--------tgaactcttccgggatggggt------
A0A2K6RW35_BCL2L2-      cacccaggtctctga--------tgaacttttccaagggggccc------
A0A2K6RW35_BCL2L2-      cacccaggtctctga--------tgaacttttccaagggggccc------
A0A2K6RW35_BCL2L2-      cacccaggtctctga--------tgaacttttccaagggggccc------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
                                                                          

A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6R5T5_BCL2L10      --------------------------------------------------
A0A2K6PPI3_MCL1-02      --------------------------------------------------
A0A2K6PPI3_MCL1-01      gcatgcttcggaaactggacatcaaaaacgaagacgatgtcaaatcttta
A0A2K6PPI3_MCL1-03      gcatgcttcggaaactggacatcaaaaacgaagacgatgtcaaatcttta
A0A2K6R2I5_BCL2-01      --------------------------------------------------
A0A2K6R2I5_BCL2-02      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
                                                                          

A0A2K6PHF2_BCL2A1-      -----------------------------------cattaactggggaag
A0A2K6PHF2_BCL2A1-      -----------------------------------cattaactggggaag
A0A2K6R5T5_BCL2L10      ------------------------------------------cggggcgg
A0A2K6PPI3_MCL1-02      --------------------------------------------------
A0A2K6PPI3_MCL1-01      tctcgagtgatggtccatgttttcagcgacggcgtaacaaactggggcag
A0A2K6PPI3_MCL1-03      tctcgagtgatggtccatgttttcagcgacggcgtaacaaactggggcag
A0A2K6R2I5_BCL2-01      --------------------------------------gaactgggggag
A0A2K6R2I5_BCL2-02      --------------------------------------gaactgggggag
A0A2K6QFA2_BCL2L1-      --------------------------------------aaactggggtcg
A0A2K6QFA2_BCL2L1-      --------------------------------------aaactggggtcg
A0A2K6QFA2_BCL2L1-      --------------------------------------aaactggggtcg
A0A2K6RW35_BCL2L2-      --------------------------------------caactggggccg
A0A2K6RW35_BCL2L2-      --------------------------------------caactggggccg
A0A2K6RW35_BCL2L2-      --------------------------------------caactggggccg
A0A2K6RW35_BCL2L2-      --------------------------------------------------
                                                                          

A0A2K6PHF2_BCL2A1-      aattgtaaccatatttgcatttgaaggtattctcat--------------
A0A2K6PHF2_BCL2A1-      aattgtaaccatatttgcatttgaaggtattctcat--------------
A0A2K6R5T5_BCL2L10      gacgg---------------------------------------------
A0A2K6PPI3_MCL1-02      --------------------------------------------------
A0A2K6PPI3_MCL1-01      gattgtgactctcatttcttttggtgcctttgtggctaaacacttgaaga
A0A2K6PPI3_MCL1-03      gattgtgactctcatttcttttggtgcctttgtggctaaacacttgaaga
A0A2K6R2I5_BCL2-01      gattgtggccttctttgagttcggtggggtcat-----------------
A0A2K6R2I5_BCL2-02      gattgtggccttctttgagttcggtggggtcat-----------------
A0A2K6QFA2_BCL2L1-      cattgtggcctttttctccttcggcggggcact-----------------
A0A2K6QFA2_BCL2L1-      cattgtggcctttttctccttcggcggggcact-----------------
A0A2K6QFA2_BCL2L1-      cattgtggcctttttctccttcggcggggcact-----------------
A0A2K6RW35_BCL2L2-      ccttgtagccttctttgtctttggggctgcact-----------------
A0A2K6RW35_BCL2L2-      ccttgtagccttctttgtctttggggctgcact-----------------
A0A2K6RW35_BCL2L2-      ccttgtagccttctttgtctttggggctgcact-----------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
                                                                          

A0A2K6PHF2_BCL2A1-      --------------------------------------------caagaa
A0A2K6PHF2_BCL2A1-      --------------------------------------------caagaa
A0A2K6R5T5_BCL2L10      ---------------------------------------gcatccgggaa
A0A2K6PPI3_MCL1-02      --------------------------------------------------
A0A2K6PPI3_MCL1-01      ccataaaccaagaaagttgcatcgaaccattagcagaaagtatcacagac
A0A2K6PPI3_MCL1-03      ccataaaccaagaaagttgcatcgaaccattagcagaaagtatcacagac
A0A2K6R2I5_BCL2-01      ---------------------------------------gtgtgtggaga
A0A2K6R2I5_BCL2-02      ---------------------------------------gtgtgtggaga
A0A2K6QFA2_BCL2L1-      ---------------------------------------gtgcgtggaaa
A0A2K6QFA2_BCL2L1-      ---------------------------------------gtgcgtggaaa
A0A2K6QFA2_BCL2L1-      ---------------------------------------gtgcgtggaaa
A0A2K6RW35_BCL2L2-      ---------------------------------------gtgtgctgaga
A0A2K6RW35_BCL2L2-      ---------------------------------------gtgtgctgaga
A0A2K6RW35_BCL2L2-      ---------------------------------------gtgtgctgaga
A0A2K6RW35_BCL2L2-      --------------------------------------------------
                                                                          

A0A2K6PHF2_BCL2A1-      acttctacgacagcaaattgccccggatgtggatacttataagga--gat
A0A2K6PHF2_BCL2A1-      acttctacgacagcaaattgccccggatgtggatacttataagga--gat
A0A2K6R5T5_BCL2L10      gcgcccacgaggccggcac----------------------------gga
A0A2K6PPI3_MCL1-02      -----------------------------------------------gga
A0A2K6PPI3_MCL1-01      gttctcgtaaggacaaaacgggactggctagttaaacaaagaggctggga
A0A2K6PPI3_MCL1-03      gttctcgtaaggacaaaacgggactggctagttaaacaaagaggctggga
A0A2K6R2I5_BCL2-01      gcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgt--gga
A0A2K6R2I5_BCL2-02      gcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgt--gga
A0A2K6QFA2_BCL2L1-      gcgtagacaaggagatgcaggtattggtgagtcggatcgcagctt--gga
A0A2K6QFA2_BCL2L1-      gcgtagacaaggagatgcaggtattggtgagtcggatcgcagctt--gga
A0A2K6QFA2_BCL2L1-      gcgtagacaaggagatgcaggtattggtgagtcggatcgcagctt--gga
A0A2K6RW35_BCL2L2-      gtgtcaacaaggagatggaaccactggtgggacaagtgcaggagt--gga
A0A2K6RW35_BCL2L2-      gtgtcaacaaggagatggaaccactggtgggacaagtgcaggagt--gga
A0A2K6RW35_BCL2L2-      gtgtcaacaaggagatggaaccactggtgggacaagtgcaggagt--gga
A0A2K6RW35_BCL2L2-      --------------------------------------------------
                                                                          

A0A2K6PHF2_BCL2A1-      ttcgtattttgttgctgagttcataatgaataacacaggagaatggataa
A0A2K6PHF2_BCL2A1-      ttcgtattttgttgctgagttcataatgaataacacaggagaatggataa
A0A2K6R5T5_BCL2L10      tggcttttgtcacttcttc-------aggaccccctttccgctggctttt
A0A2K6PPI3_MCL1-02      tgggtttgtggagttcttccatgtagagga---cctagaaggtggcatc-
A0A2K6PPI3_MCL1-01      tgggtttgtggagttcttccatgtagagga---cctagaaggtggcatc-
A0A2K6PPI3_MCL1-03      tgggtttgtggagttcttccatgtagagga---cctagaaggtggcatc-
A0A2K6R2I5_BCL2-01      tga-----------ctgagtacctgaaccggcacctgcacacttggatcc
A0A2K6R2I5_BCL2-02      tga-----------ctgagtacctgaaccggcacctgcacacttggatcc
A0A2K6QFA2_BCL2L1-      tgg-----------ccacttatctgaatgaccacctagagccttggatcc
A0A2K6QFA2_BCL2L1-      tgg-----------ccacttatctgaatgaccacctagagccttggatcc
A0A2K6QFA2_BCL2L1-      tgg-----------ccacttatctgaatgaccacctagagccttggatcc
A0A2K6RW35_BCL2L2-      tgg-----------tggcctacctggagacgcggctggctgactggatcc
A0A2K6RW35_BCL2L2-      tgg-----------tggcctacctggagacgcggctggctgactggatcc
A0A2K6RW35_BCL2L2-      tgg-----------tggcctacctggagacgcggctggctgactggatcc
A0A2K6RW35_BCL2L2-      --------------------------------------------------
                                                                          

A0A2K6PHF2_BCL2A1-      ggcaaaacggaggct-gggaaaa---------------------------
A0A2K6PHF2_BCL2A1-      ggcaaaacggaggctgggggaaa---------------------------
A0A2K6R5T5_BCL2L10      tggagaa-aactgctgatcc------------------------------
A0A2K6PPI3_MCL1-02      ---agaa-atgtgctg---c------------------------------
A0A2K6PPI3_MCL1-01      ---agaa-atgtgctg---c------------------------------
A0A2K6PPI3_MCL1-03      ---agaa-atgtgctg---c------------------------------
A0A2K6R2I5_BCL2-01      aggataacggaggctggg--------------------------------
A0A2K6R2I5_BCL2-02      aggataacggaggctggc--------------------------------
A0A2K6QFA2_BCL2L1-      aggagaacggcggctggg--------------------------------
A0A2K6QFA2_BCL2L1-      aggagaacggcggctggg--------------------------------
A0A2K6QFA2_BCL2L1-      aggagaacggcggctggg--------------------------------
A0A2K6RW35_BCL2L2-      acagcagtgggggctgggcg------------------------------
A0A2K6RW35_BCL2L2-      acagcagtgggggctgggcg------------------------------
A0A2K6RW35_BCL2L2-      acagcagtgggggctgggagctggaagctatcaaagctcgagtcagggag
A0A2K6RW35_BCL2L2-      --------------------------------------------------
                                                                          

A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6R5T5_BCL2L10      --------------------------------------------------
A0A2K6PPI3_MCL1-02      --------------------------------------------------
A0A2K6PPI3_MCL1-01      --------------------------------------------------
A0A2K6PPI3_MCL1-03      --------------------------------------------------
A0A2K6R2I5_BCL2-01      --------------------------------------------------
A0A2K6R2I5_BCL2-02      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      atggaggaagaagctgagaagctaaaggagctacagaacgaggtagagaa
A0A2K6RW35_BCL2L2-      atggaggaagaagctgagaagctaaaggagctacagaacgaggtagagaa
                                                                          

A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6R5T5_BCL2L10      --------------------------------------------------
A0A2K6PPI3_MCL1-02      --------------------------------------------------
A0A2K6PPI3_MCL1-01      --------------------------------------------------
A0A2K6PPI3_MCL1-03      --------------------------------------------------
A0A2K6R2I5_BCL2-01      --------------------------------------------------
A0A2K6R2I5_BCL2-02      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      ------------------acacttttgtg---------------------
A0A2K6QFA2_BCL2L1-      ------------------acacttttgtg---------------------
A0A2K6QFA2_BCL2L1-      ------------------acacttttgtg---------------------
A0A2K6RW35_BCL2L2-      ------------gagttcacagctctatacggggacgg------------
A0A2K6RW35_BCL2L2-      ------------gagttcacagctctatacggggacgg------------
A0A2K6RW35_BCL2L2-      gcagatgaatatgagtccac--ctccaggcaatgctggcccagtgatcat
A0A2K6RW35_BCL2L2-      gcagatgaatatgagtccac--ctccaggcaatgctggcccagtgatcat
                                                                          

A0A2K6PHF2_BCL2A1-      tggctttgtaaagaagtttgaacctaaatctgg-----------------
A0A2K6PHF2_BCL2A1-      tggc-------acaatcacatgcctatg-ctag-----------------
A0A2K6R5T5_BCL2L10      aggctttcctggcatgcttgttaacaa-----------------------
A0A2K6PPI3_MCL1-02      tggcttt-------------------------------------------
A0A2K6PPI3_MCL1-01      tggcttt-------------------------------------------
A0A2K6PPI3_MCL1-03      tggcttt-------------------------------------------
A0A2K6R2I5_BCL2-01      atgcctttgtggaactgtacggccc-------------------------
A0A2K6R2I5_BCL2-02      gtac---------aatgt--------------------------------
A0A2K6QFA2_BCL2L1-      gaactctatgggaacaatg-------------------------------
A0A2K6QFA2_BCL2L1-      gaactctatgggaacaatg-------------------------------
A0A2K6QFA2_BCL2L1-      gaactctatgggaacaatg-------------------------------
A0A2K6RW35_BCL2L2-      ggccctggaggaggcg-cggcgtctg------------------------
A0A2K6RW35_BCL2L2-      ggccctggaggaggcg-cggcgtctg------------------------
A0A2K6RW35_BCL2L2-      gtccattgaggagaagatggaggctgatgcccgttccatctatgttggca
A0A2K6RW35_BCL2L2-      gtccattgaggagaagatggaggctgatgcccgttccatctatgttggca
                           *                                              

A0A2K6PHF2_BCL2A1-      ------------------ctggatgacttttctag---------------
A0A2K6PHF2_BCL2A1-      ------------------tagagtcagtggcccac---------------
A0A2K6R5T5_BCL2L10      ------------------cagccttcggttacctc---------------
A0A2K6PPI3_MCL1-02      -----------------------tgcaggtgttgc---------------
A0A2K6PPI3_MCL1-01      -----------------------tgcaggtgttgc---------------
A0A2K6PPI3_MCL1-03      -----------------------tgcaggtgttgc---------------
A0A2K6R2I5_BCL2-01      ------------------cagcatgcggcctctgt---------------
A0A2K6R2I5_BCL2-02      --------------------gcacgtggt---------------------
A0A2K6QFA2_BCL2L1-      ------------------cagcagccgagagccga---------------
A0A2K6QFA2_BCL2L1-      ------------------cagcagccgagagccga---------------
A0A2K6QFA2_BCL2L1-      ------------------cagcagccgagagccga---------------
A0A2K6RW35_BCL2L2-      ------------------cgggag--gggaactgg---------------
A0A2K6RW35_BCL2L2-      ------------------cgggag--gggaactgg---------------
A0A2K6RW35_BCL2L2-      atgtggactatggtgcaacagcag--aagagctggaagctcactttcatg
A0A2K6RW35_BCL2L2-      atgtggactatggtgcaacagcag--aagagctggaagctcactttcatg
                                                                          

A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6R5T5_BCL2L10      --------------------------------------------------
A0A2K6PPI3_MCL1-02      --------------------------------------------------
A0A2K6PPI3_MCL1-01      --------------------------------------------------
A0A2K6PPI3_MCL1-03      --------------------------------------------------
A0A2K6R2I5_BCL2-01      --------------------------------------------------
A0A2K6R2I5_BCL2-02      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      --------------------------------------------------
A0A2K6RW35_BCL2L2-      gctgtggatcagtcaaccgtgttaccatactctgtgacaaatttagtggc
A0A2K6RW35_BCL2L2-      gctgtggatcagtcaaccgtgttaccatactctgtgacaaatttagtggc
                                                                          

A0A2K6PHF2_BCL2A1-      -------------------------------------aagttacaggaaa
A0A2K6PHF2_BCL2A1-      -------------------------------------aagaagaagaaaa
A0A2K6R5T5_BCL2L10      ---------------------------------tggacacgattattatg
A0A2K6PPI3_MCL1-02      ---------------------------------tgg--------agtagg
A0A2K6PPI3_MCL1-01      ---------------------------------tgg--------agtagg
A0A2K6PPI3_MCL1-03      ---------------------------------tgg--------agtagg
A0A2K6R2I5_BCL2-01      -----------------------------------ttgatttctcctggc
A0A2K6R2I5_BCL2-02      ------------------------------------------------gc
A0A2K6QFA2_BCL2L1-      -------------------------------------aagggccag-gag
A0A2K6QFA2_BCL2L1-      -------------------------------------aagggccag-gag
A0A2K6QFA2_BCL2L1-      -------------------------------------aagggccag-gag
A0A2K6RW35_BCL2L2-      ---------------------------------------gcatcagtgag
A0A2K6RW35_BCL2L2-      ---------------------------------------gcatcagtgag
A0A2K6RW35_BCL2L2-      catcccaaagggtttgcgtatatagagttctcagacaaagagtcagtgag
A0A2K6RW35_BCL2L2-      catcccaaagggtttgcgtatatagagttctcagacaaagagtcagtgag
                                                                          

A0A2K6PHF2_BCL2A1-      gatctgtgaaat--------------------------------------
A0A2K6PHF2_BCL2A1-      tggctttgtaa---------------------------------------
A0A2K6R5T5_BCL2L10      agt---tttaaa--------atttttaa----------------------
A0A2K6PPI3_MCL1-02      agctggtttggc--------atatctaa----------------------
A0A2K6PPI3_MCL1-01      agctggtttggc--------atatctaa----------------------
A0A2K6PPI3_MCL1-03      agctggtttggc--------atatctaa----------------------
A0A2K6R2I5_BCL2-01      tgtctctgaagactctgctcagt---------------------------
A0A2K6R2I5_BCL2-02      cgcttcag------------------------------------------
A0A2K6QFA2_BCL2L1-      cgcttcaaccgc------tggttcctga----------------------
A0A2K6QFA2_BCL2L1-      cgcttcaaccgc------tggttcctga----------------------
A0A2K6QFA2_BCL2L1-      cgcttcaaccgc------tggttcctga----------------------
A0A2K6RW35_BCL2L2-      gac-----------------agtgctga----------------------
A0A2K6RW35_BCL2L2-      gac-----------------agtgctga----------------------
A0A2K6RW35_BCL2L2-      gacttccttggccttagatgagtccctatttagaggaaggcaaatcaagg
A0A2K6RW35_BCL2L2-      gacttccttggccttagatgagtccctatttagaggaaggcaaatcaagg
                                                                          

A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6R5T5_BCL2L10      --------------------------------------------------
A0A2K6PPI3_MCL1-02      --------------------------------------------------
A0A2K6PPI3_MCL1-01      --------------------------------------------------
A0A2K6PPI3_MCL1-03      --------------------------------------------------
A0A2K6R2I5_BCL2-01      --------------------------------------------------
A0A2K6R2I5_BCL2-02      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------cgggc-
A0A2K6QFA2_BCL2L1-      --------------------------------------------cgggc-
A0A2K6QFA2_BCL2L1-      --------------------------------------------cgggc-
A0A2K6RW35_BCL2L2-      --------------------------------------------cgggg-
A0A2K6RW35_BCL2L2-      --------------------------------------------cgggg-
A0A2K6RW35_BCL2L2-      tgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggt
A0A2K6RW35_BCL2L2-      tgatcccaaaacgaaccaacagaccaggcatcagcacaacagaccggggt
                                                                          

A0A2K6PHF2_BCL2A1-      -------------------------------gctatctctcctgaagcaa
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6R5T5_BCL2L10      -------------------------------cccacttctacctgcccaa
A0A2K6PPI3_MCL1-02      -------------------------------taagat------agcctta
A0A2K6PPI3_MCL1-01      -------------------------------taagat------ag-----
A0A2K6PPI3_MCL1-03      -------------------------------taagat------ag-----
A0A2K6R2I5_BCL2-01      -------------ttggccctggtgggagcttgcatcaccctgggtgcct
A0A2K6R2I5_BCL2-02      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      -------------atgactgtggccgg----cgtggttctgctgggctca
A0A2K6QFA2_BCL2L1-      -------------atgactgtggccgg----cgtggttctgctgggctca
A0A2K6QFA2_BCL2L1-      -------------atgactgtggccgg----cgtggttctgctgggctca
A0A2K6RW35_BCL2L2-      -------------gccgtggcactgggggccctggtaactgtaggggcct
A0A2K6RW35_BCL2L2-      -------------gccgtggcactgggggccctggtaactgtaggggcct
A0A2K6RW35_BCL2L2-      tttccacgagcccgctaccgcgcccggaccaccaactacaacagttcccg
A0A2K6RW35_BCL2L2-      tttccacgagcccgctaccgcgcccggaccaccaactacaacagttcccg
                                                                          

A0A2K6PHF2_BCL2A1-      tactg---------------------------------------------
A0A2K6PHF2_BCL2A1-      --------------------------------------------------
A0A2K6R5T5_BCL2L10      ct------------------------------------------------
A0A2K6PPI3_MCL1-02      ct------------------------------------------------
A0A2K6PPI3_MCL1-01      --------------------------------------------------
A0A2K6PPI3_MCL1-03      --------------------------------------------------
A0A2K6R2I5_BCL2-01      atctg--------------------ggccac-------------------
A0A2K6R2I5_BCL2-02      ----g--------------------ggatgt-------------------
A0A2K6QFA2_BCL2L1-      ctctt-------------------cagtcgg-------------------
A0A2K6QFA2_BCL2L1-      ctctt-------------------cagtcgg-------------------
A0A2K6QFA2_BCL2L1-      ctctt-------------------cagtcgg-------------------
A0A2K6RW35_BCL2L2-      tttttgct-----------------agcaag-------------------
A0A2K6RW35_BCL2L2-      tttttgct-----------------agcaag-------------------
A0A2K6RW35_BCL2L2-      ctctcgcttctacagtggttttaacagcaggccccggggtcgcgtctaca
A0A2K6RW35_BCL2L2-      ctctcgcttctacagtggttttaacagcaggccccggggtcgcgtctaca
                                                                          

A0A2K6PHF2_BCL2A1-      -------------------------------------ttga
A0A2K6PHF2_BCL2A1-      -----------------------------------------
A0A2K6R5T5_BCL2L10      -------------------------------------gtga
A0A2K6PPI3_MCL1-02      -------------------------------------gtaa
A0A2K6PPI3_MCL1-01      -----------------------------------------
A0A2K6PPI3_MCL1-03      -----------------------------------------
A0A2K6R2I5_BCL2-01      -----------------------------------aagtga
A0A2K6R2I5_BCL2-02      -----------------------------------gattga
A0A2K6QFA2_BCL2L1-      -----------------------------------aaatga
A0A2K6QFA2_BCL2L1-      -----------------------------------aaatga
A0A2K6QFA2_BCL2L1-      -----------------------------------aaatga
A0A2K6RW35_BCL2L2-      --------------------------------------tga
A0A2K6RW35_BCL2L2-      --------------------------------------tga
A0A2K6RW35_BCL2L2-      --ggtcaggatag----------------------------
A0A2K6RW35_BCL2L2-      ggggccgggctagagcgacatcatggtattccccttactaa
                                                                 

© 1998-2022Legal notice