Dataset for CDS Unclassified of Organism Erpetoichthys calabaricus

[Download (right click)]

5 sequence(s)

>gnl|bcl2dbcds|A0A8C4SW03_uncBAX-01 Putative BCL2-associated X gene OS=[Eukaryota] Erpetoichthys calabaricus (length=423 residues).
atgcaacatttaaatttggcttattgcaatttgcatttatttacctttcactcatcccttattttttcacttttgcagat
taacgacatacaaccaagcagggagacattcataaaaattgcacaattatttcataacagaaatttgaactggggcagca
tagtgggattactttacttcgaatgtaaattggcaatgaaggctctatgccagaaagctccagaaatgatgagatctgta
atatcttggaccataagctacatcagggagcatttgcttatttggatcatggatcagggtggttgggagggaatccactg
ttactttaatcagtcttcgtggcctgcaataggtgctttcgtagctgactcgcttttttggactaaagagtcacatttaa
tacccaaagtgcgctttaactga
>gnl|bcl2dbcds|A0A8C4SW03_uncBAX-02 Putative BCL2-associated X gene OS=[Eukaryota] Erpetoichthys calabaricus (length=411 residues).
atgtcagttacttgccactttattgaaaattacaaaatggtgtccgatcttctggtttgttcgagtccagtgacagacac
ttctgagaacttaagactaaaagtttcctggatacttctggaccccagtcataaaaagataaagaaactggctgaagttt
caaagattttagaaatggcattttactttgcttgtaaattggcaataaaggctctatgccagaaagctccagaaatgatg
agatctgtaatatcttggaccataagctacatcagggagcatttgcttatttggatcatggatcagggtggttgggaggg
aatccactgttactttaatcagtcttcgtggcctgcaataggtgctttcgtagctgactgtcatgaaggagtgaaggtaa
actaccactag
>gnl|bcl2dbcds|A0A8C4SW03_uncBAX-03 Putative BCL2-associated X gene OS=[Eukaryota] Erpetoichthys calabaricus (length=375 residues).
atgaacaagaggagtcacaagcatttgctgtttggagattctttgaagaacgagcaactgctaaaagtttcctggatact
tctggaccccagtcataaaaagataaagaaactggctgaagtttcaaagattttagaaatggcattttactttgcttgta
aattggcaataaaggctctatgccagaaagctccagaaatgatgagatctgtaatatcttggaccataagctacatcagg
gagcatttgcttatttggatcatggatcagggtggttgggagggaatccactgttactttaatcagtcttcgtggcctgc
aataggtgctttcgtagctgactgtcatgaaggagtgaaggtaaactaccactag
>gnl|bcl2dbcds|A0A8C4SW03_uncBAX-04 Putative BCL2-associated X gene OS=[Eukaryota] Erpetoichthys calabaricus (length=453 residues).
agacactcacaaaagaaattcctcagcaaatacaatactggaagtgagattgtatcttgcggagcctcttttccaaagaa
gtgcagacccactgagctggtaggagaccaaggcttcagtttacccacgtcttgcgcatgtgatgtttcctggatacttc
tggaccccagtcataaaaagataaagaaactggctgaagtttcaaagattttagaaatggcattttactttgcttgtaaa
ttggcaataaaggctctatgccagaaagctccagaaatgatgagatctgtaatatcttggaccataagctacatcaggga
gcatttgcttatttggatcatggatcagggtggttgggagggaatccactgttactttaatcagtcttcgtggcctgcaa
taggtgctttcgtagctgactgtcatgaaggagtgaaggtaaactaccactag
>gnl|bcl2dbcds|A0A8C4XEX4_uncBCLWAV-01 Putative BCL2 homolog found in water-living anamniote vertebrates gene OS=[Eukaryota] Erpetoichthys calabaricus (length=612 residues).
tgccagctagtgccccgtcctgtcacccatcaatcacaagtagaccccaccgtgcgggaagcctacctgatggcccacga
ttacatcgattatgtgaccaaggccccaggggtctcaggacggccaccgtcaaaggcatgtgcagcgctgcgacatgcag
gggacactttgatccacaggtttcctctgttcttcaagcgctggcctcgactcttccaggaggtgaccgaggacaacgct
gccacgacgctcatccagatcctggaggagcactttgggcctcaagtggccggaggccgcactcgggagctgccctggag
tgccatcctctccatctacatgctggctggtcagatggcacagcactgccaggagcgcggactgcaaggcgcactgcccg
tcctaaaggagagagtgggcgagtatgtggagaggaccgtgtgcccgcagctcagacagaagggaggttggtctggcttt
gaggcccgctacggtgagaaggaagaccccgagaggatggccatcagagtctgctgcgggactctcgtcttgctggctgc
tgccattctaacctacttcttctggaagcgtcgaccaccttggacatcctga
© 1998-2023Legal notice