Dataset for CDS MCL-1 of organism Astyanax mexicanus

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|A0A3B1IEV7_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Astyanax mexicanus GN=MCL-1 (length=729 residues).
atgaacccaaccgcgatcagcctcctgtgtgacggaacaagcccggttctctacagaaccgagaaagaggagaagctgcc
ccggacggagcggccggaacgcggcctggaggggctgcagtccgctaaaggagtctccatgggcggcgggtctctgcccg
actccccgctggcggacgtagacttcatccaggactttagctgccgctgcccgggcgcgctggaggcggagacccgccgc
ctgatggtggagttttaccgcgggtacctgggccagaagccccgggagcagagcccggccctgcggaccatgagccgggt
ggtggcgggggtcgtcctcaaacacgggatcgcctacaacggtatggtccagaagctgaatttggaggagcaggacgaca
gtatggacattattagcagcgtagctaaggctctgtttagcgacggaaccacgaactgggggcggatcgttagcctggtg
gcgttcggcgcggtggtgtgtgatcatctgaagaagaagagtcgagatcactgcgtggagaacgtcgcccaacacatctc
cacctacctcaacacccaccaacaccagtggctcatcaacaacaacgcctgggacggattcgtggaattcttccgcgagg
acgactcagaatcacgagtccgaaacgccctgatggccttcgctggatttgccgggctgggggcggggctagcactactg
atgcgctga
>gnl|bcl2dbcds|A0A3B1K5R1_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Astyanax mexicanus GN=MCL-1 (length=735 residues).
atgatgagcccacaggatatgtgttcgtataacaagaagacggccgacattgttccccgggtcgctgttcgcggaggagg
gggaggagcggggctctcgctcggtctcgcggccgacattagacctaccaggcccggcgtcgacgacggctcagtgccca
gctcccccttgtcggactgcggggagatggccgttgggaactgcaagcagtacgaaacgctggacggagacacgcgagag
attatcagtgactttctgaggaacttttgcggactctctcggtcctgtggaggacacggtgcggttgtacagacaatgaa
gcgggtggtggacgatctggtggtcaaacatgggattgcgtacaaaggtatgttgaacaaactgggtatggaagacagag
gagatgacatgtatgtaattagggcagtagctaaggagctattcagtgatggcatcaccaactggggcagggtcgccagc
ctggtggcctttggagcagtggtgtccaagcatcagcatgacatgggccgaggccactgtgtgagtctagtgggtgaaga
actatcctcatatcttctgtcagacgaaagggactggctcctaaaaaacaaagcatgggatggctttgtggagttttttc
gtgttcctgatcctgagtcaacgatgagaaatgcattaatggcctttgttactgtggcaggtcttggagcctcaatagca
tttttggcaagataa
>gnl|bcl2dbcds|A0A8B9JW80_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Astyanax mexicanus GN=MCL-1 (length=729 residues).
atgcatatttttctaagccacaacgtgcagaacgagactcggtttaagaccgtcgacattgttccccgggtcgctgttcg
cggaggagggggaggagcggggctctcgctcggtctcgcggccgacattagacctaccaggcccggcgtcgacgacggct
cagtgcccagctcccccttgtcggactgcggggagatggccgttgggaactgcaagcagtacgaaacgctggacggagac
acgcgagagattatcagtgactttctgaggaacttttgcggactctctcggtcctgtggaggacacggtgcggttgtaca
gacaatgaagcgggtggtggacgatctggtggtcaaacatgggattgcgtacaaaggttggttagcttatctaagagatg
acatgtatgtaattagggcagtagctaaggagctattcagtgatggcatcaccaactggggcagggtcgccagcctggtg
gcctttggagcagtggtgtccaagcatcagcatgacatgggccgaggccactgtgtgagtctagtgggtgaagaactatc
ctcatatcttctgtcagacgaaagggactggctcctaaaaaacaaagcatgggatggctttgtggagttttttcgtgttc
ctgatcctgagtcaacgatgagaaatgcattaatggcctttgttactgtggcaggtcttggagcctcaatagcatttttg
gcaagataa
© 1998-2022Legal notice