Dataset for CDS MCL-1 of organism Felis catus

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A337S3J9_MCL1-02      atgtttggcctcaagagaaacgctgtaatcggactcaacctctactgtgg
A0A337S3J9_MCL1-01      atgtttggcctcaagagaaacgctgtaatcggactcaacctctactgtgg
Q7YRZ9_MCL1-01          atgtttggcctcaagagaaacgctgtaatcggactcaacctctactgtgg
A0A337S3J9_MCL1-03      atgtttggcctcaagagaaacgctgtaatcggactcaacctctactgtgg
A0A337S3J9_MCL1-04      atgtttggcctcaagagaaacgctgtaatcggactcaacctctactgtgg
                        **************************************************

A0A337S3J9_MCL1-02      gggggccgggttggcggccgggagcggcggcgcctcctcttcgggagggc
A0A337S3J9_MCL1-01      gggggccgggttggcggccgggagcggcggcgcctcctcttcgggagggc
Q7YRZ9_MCL1-01          gggggccgggttggcggccgggagcggcggcgcctcctcttcgggagggc
A0A337S3J9_MCL1-03      gggggccgggttggcggccgggagcggcggcgcctcctcttcgggagggc
A0A337S3J9_MCL1-04      gggggccgggttggcggccgggagcggcggcgcctcctcttcgggagggc
                        **************************************************

A0A337S3J9_MCL1-02      ggcttgtggctgtggggaaggaggccacggccaggcgagaggtaggggga
A0A337S3J9_MCL1-01      ggcttgtggctgtggggaaggaggccacggccaggcgagaggtaggggga
Q7YRZ9_MCL1-01          ggcttgtggctgtggggaaggaggccacggccaggcgagaggtaggggga
A0A337S3J9_MCL1-03      ggcttgtggctgtggggaaggaggccacggccaggcgagaggtaggggga
A0A337S3J9_MCL1-04      ggcttgt-------------------------------------------
                        *******                                           

A0A337S3J9_MCL1-02      ggggaagccggtgcggtgattggcggaagcgccggcgcgagccccccagc
A0A337S3J9_MCL1-01      ggggaagccggtgcggtgattggcggaagcgccggcgcgagccccccagc
Q7YRZ9_MCL1-01          ggggaagccggtgcggtgattggcggaagcgccggcgcgagccccccagc
A0A337S3J9_MCL1-03      ggggaagccggtgcggtgattggcggaagcgccggcgcgagccccccagc
A0A337S3J9_MCL1-04      --------------------------------------------------
                                                                          

A0A337S3J9_MCL1-02      cactctcgcgcccgacgcccggagggtcgcgcggccctcgcccattggtg
A0A337S3J9_MCL1-01      cactctcgcgcccgacgcccggagggtcgcgcggccctcgcccattggtg
Q7YRZ9_MCL1-01          cactctcgcgcccgacgcccggagggtcgcgcggccctcgcccattggtg
A0A337S3J9_MCL1-03      cactctcgcgcccgacgcccggagggtcgcgcggccctcgcccattggtg
A0A337S3J9_MCL1-04      --------------------------------------------------
                                                                          

A0A337S3J9_MCL1-02      ccgagggccccgacgtcaccgcgacccccccgaagctgctgttcttcgcg
A0A337S3J9_MCL1-01      ccgagggccccgacgtcaccgcgacccccccgaagctgctgttcttcgcg
Q7YRZ9_MCL1-01          ccgagggccccgacgtcaccgcgacccccccgaagctgctgttcttcgcg
A0A337S3J9_MCL1-03      ccgagggccccgacgtcaccgcgacccccccgaagctgctgttcttcgcg
A0A337S3J9_MCL1-04      --------------------------------------------------
                                                                          

A0A337S3J9_MCL1-02      gccacccgctgtgcgtcgccgcctgaaaagatggaaggcccagccgccga
A0A337S3J9_MCL1-01      gccacccgctgtgcgtcgccgcctgaaaagatggaaggcccagccgccga
Q7YRZ9_MCL1-01          gccacccgctgtgcgtcgccgcctgaagagatggaaggcccagccgccga
A0A337S3J9_MCL1-03      gccacccgctgtgcgtcgccgcctgaaaagatggaaggcccagccgccga
A0A337S3J9_MCL1-04      --------------------------------------------------
                                                                          

A0A337S3J9_MCL1-02      cgccatcatgtcgcccgaagaggagctagacgggtacgagccagaacctc
A0A337S3J9_MCL1-01      cgccatcatgtcgcccgaagaggagctagacgggtacgagccagaacctc
Q7YRZ9_MCL1-01          cgccatcatgtcgcccgaagaggagctagacgggtacgagccagaacctc
A0A337S3J9_MCL1-03      cgccatcatgtcgcccgaagaggagctagacgggtacgagccagaacctc
A0A337S3J9_MCL1-04      --------------------------------------------------
                                                                          

A0A337S3J9_MCL1-02      tggggaagcggccggctgtcctgcctttgctggagttggtcggggaggcc
A0A337S3J9_MCL1-01      tggggaagcggccggctgtcctgcctttgctggagttggtcggggaggcc
Q7YRZ9_MCL1-01          tggggaagcggccggctgtcctgcctttgctggagttggtcggggaggcc
A0A337S3J9_MCL1-03      tggggaagcggccggctgtcctgcctttgctggagttggtcggggaggcc
A0A337S3J9_MCL1-04      --------------------------------------------------
                                                                          

A0A337S3J9_MCL1-02      agcagtggccccggcacagacggctcactgccctcgacgccacccccagc
A0A337S3J9_MCL1-01      agcagtggccccggcacagacggctcactgccctcgacgccacccccagc
Q7YRZ9_MCL1-01          agcagtggccccggcacagacggctcactgccctcgacgccacccccagc
A0A337S3J9_MCL1-03      agcagtggccccggcacagacggctcactgccctcgacgccacccccagc
A0A337S3J9_MCL1-04      --------------------------------------------------
                                                                          

A0A337S3J9_MCL1-02      agaggaggaggaggacgagttgttccggcagtcgctggagattatctctc
A0A337S3J9_MCL1-01      agaggaggaggaggacgagttgttccggcagtcgctggagattatctctc
Q7YRZ9_MCL1-01          agaggaggaggaggacgagttgttccggcagtcgctggagattatctctc
A0A337S3J9_MCL1-03      agaggaggaggaggacgagttgttccggcagtcgctggagattatctctc
A0A337S3J9_MCL1-04      --------------------------------------------------
                                                                          

A0A337S3J9_MCL1-02      ggtaccttcgggagcaggcgaccggcgccaaggacgcgaaaccactgggc
A0A337S3J9_MCL1-01      ggtaccttcgggagcaggcgaccggcgccaaggacgcgaaaccactgggc
Q7YRZ9_MCL1-01          ggtaccttcgggagcaggcgaccggcgccaaggacgcgaaaccactgggc
A0A337S3J9_MCL1-03      ggtaccttcgggagcaggcgaccggcgccaaggacgcgaaaccactgggc
A0A337S3J9_MCL1-04      ----------------ggcgaccggcgccaaggacgcgaaaccactgggc
                                        **********************************

A0A337S3J9_MCL1-02      gggtctggggcggccagccgaaaggcgttagagaccctccgacgggtcgg
A0A337S3J9_MCL1-01      gggtctggggcggccagccgaaaggcgttagagaccctccgacgggtcgg
Q7YRZ9_MCL1-01          gggtctggggcggccagccgaaaggcgttagagaccctccgacgggtcgg
A0A337S3J9_MCL1-03      gggtctggggcggccagccgaaaggcgttagagaccctccgacgggtcgg
A0A337S3J9_MCL1-04      gggtctggggcggccagccgaaaggcgttagagaccctccgacgggtcgg
                        **************************************************

A0A337S3J9_MCL1-02      ggacggcgtgcagcgcaaccacgagaccgccttccaaggcatgcttcgga
A0A337S3J9_MCL1-01      ggacggcgtgcagcgcaaccacgagaccgccttccaaggcatgcttcgga
Q7YRZ9_MCL1-01          ggacggcgtgcagcgcaaccacgagaccgccttccaaggcatgcttcgga
A0A337S3J9_MCL1-03      ggacggcgtgcagcgcaaccacgagaccgccttccaaggcatgcttcgga
A0A337S3J9_MCL1-04      ggacggcgtgcagcgcaaccacgagaccgccttccaaggcatgcttcgga
                        **************************************************

A0A337S3J9_MCL1-02      aactggacatcaaaaacgaaaacgatgtcaaatctttgtctcgagtgatg
A0A337S3J9_MCL1-01      aactggacatcaaaaacgaaaacgatgtcaaatctttgtctcgagtgatg
Q7YRZ9_MCL1-01          aactggacatcaaaaacgaaaacgatgtcaaatctttgtctcgagtgatg
A0A337S3J9_MCL1-03      aactggacatcaaaaacgaaaacgatgtcaaatctttgtctcgagtgatg
A0A337S3J9_MCL1-04      aactggacatcaaaaacgaaaacgatgtcaaatctttgtctcgagtgatg
                        **************************************************

A0A337S3J9_MCL1-02      gtccatgttttcagtgacggagtaacaaactggggcaggattgtgactct
A0A337S3J9_MCL1-01      gtccatgttttcagtgacggagtaacaaactggggcaggattgtgactct
Q7YRZ9_MCL1-01          gtccatgttttcagtgacggagtaacaaactggggcaggattgtgactct
A0A337S3J9_MCL1-03      gtccatgttttcagtgacggagtaacaaactggggcaggattgtgactct
A0A337S3J9_MCL1-04      gtccatgttttcagtgacggagtaacaaactggggcaggattgtgactct
                        **************************************************

A0A337S3J9_MCL1-02      tatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaag
A0A337S3J9_MCL1-01      tatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaag
Q7YRZ9_MCL1-01          tatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaag
A0A337S3J9_MCL1-03      tatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaag
A0A337S3J9_MCL1-04      tatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaag
                        **************************************************

A0A337S3J9_MCL1-02      aaagctgcatcgaaccattagcagaaagcatcacagatgttcttgtaagg
A0A337S3J9_MCL1-01      aaagctgcatcgaaccattagcagaaagcatcacagatgttcttgtaagg
Q7YRZ9_MCL1-01          aaagctgcatcgaaccattagcagaaagcatcacagatgttcttgtaagg
A0A337S3J9_MCL1-03      aaagctgcatcgaaccattagcagaaagcatcacagatgttcttgtaagg
A0A337S3J9_MCL1-04      aaagctgcatcgaaccattagcagaaagcatcacagatgttcttgtaagg
                        **************************************************

A0A337S3J9_MCL1-02      acaaaacgagactggctagtcaaacaaagaggctggggcaa------gga
A0A337S3J9_MCL1-01      acaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtgga
Q7YRZ9_MCL1-01          acaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtgga
A0A337S3J9_MCL1-03      acaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtgga
A0A337S3J9_MCL1-04      acaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtgga
                        *************************************          ***

A0A337S3J9_MCL1-02      ggccccaacttctctctgcttggcccatttgctgtgttcaga--------
A0A337S3J9_MCL1-01      gtt-----cttccatgtagaggacctagaaggtgg---------------
Q7YRZ9_MCL1-01          gtt-----cttccatgtagaggacctagaaggtggcatcagaaatgtgct
A0A337S3J9_MCL1-03      gtt-----cttccatgtagaggacctagaaggtggcatcagaaatgtgct
A0A337S3J9_MCL1-04      gtt-----cttccatgtagaggacctagaaggtggcatcagaaatgtgct
                        *       ****  * *    * ** *   * **                

A0A337S3J9_MCL1-02      ----------gcaggtgtag------------------------------
A0A337S3J9_MCL1-01      ------------agataaggcttga-------------------------
Q7YRZ9_MCL1-01          gctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaa
A0A337S3J9_MCL1-03      gctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaa
A0A337S3J9_MCL1-04      gctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaa
                                    ** *   *                              

A0A337S3J9_MCL1-02      --------
A0A337S3J9_MCL1-01      --------
Q7YRZ9_MCL1-01          taagatag
A0A337S3J9_MCL1-03      taagatag
A0A337S3J9_MCL1-04      taagatag
                                

© 1998-2022Legal notice