Dataset for CDS MCL-1 of organism Felis catus

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A337S3J9_MCL1-01      atgtttggcctcaagagaaacgctgtaatcggactcaacctctactgtgg
Q7YRZ9_MCL1-01          atgtttggcctcaagagaaacgctgtaatcggactcaacctctactgtgg
A0A337S3J9_MCL1-04      atgtttggcctcaagagaaacgctgtaatcggactcaacctctactgtgg
A0A337S3J9_MCL1-03      atgtttggcctcaagagaaacgctgtaatcggactcaacctctactgtgg
                        **************************************************

A0A337S3J9_MCL1-01      gggggccgggttggcggccgggagcggcggcgcctcctcttcgggagggc
Q7YRZ9_MCL1-01          gggggccgggttggcggccgggagcggcggcgcctcctcttcgggagggc
A0A337S3J9_MCL1-04      gggggccgggttggcggccgggagcggcggcgcctcctcttcgggagggc
A0A337S3J9_MCL1-03      gggggccgggttggcggccgggagcggcggcgcctcctcttcgggagggc
                        **************************************************

A0A337S3J9_MCL1-01      ggcttgtggctgtggggaaggaggccacggccaggcgagaggtaggggga
Q7YRZ9_MCL1-01          ggcttgtggctgtggggaaggaggccacggccaggcgagaggtaggggga
A0A337S3J9_MCL1-04      ggcttgt-------------------------------------------
A0A337S3J9_MCL1-03      ggcttgtggctgtggggaaggaggccacggccaggcgagaggtaggggga
                        *******                                           

A0A337S3J9_MCL1-01      ggggaagccggtgcggtgattggcggaagcgccggcgcgagccccccagc
Q7YRZ9_MCL1-01          ggggaagccggtgcggtgattggcggaagcgccggcgcgagccccccagc
A0A337S3J9_MCL1-04      --------------------------------------------------
A0A337S3J9_MCL1-03      ggggaagccggtgcggtgattggcggaagcgccggcgcgagccccccagc
                                                                          

A0A337S3J9_MCL1-01      cactctcgcgcccgacgcccggagggtcgcgcggccctcgcccattggtg
Q7YRZ9_MCL1-01          cactctcgcgcccgacgcccggagggtcgcgcggccctcgcccattggtg
A0A337S3J9_MCL1-04      --------------------------------------------------
A0A337S3J9_MCL1-03      cactctcgcgcccgacgcccggagggtcgcgcggccctcgcccattggtg
                                                                          

A0A337S3J9_MCL1-01      ccgagggccccgacgtcaccgcgacccccccgaagctgctgttcttcgcg
Q7YRZ9_MCL1-01          ccgagggccccgacgtcaccgcgacccccccgaagctgctgttcttcgcg
A0A337S3J9_MCL1-04      --------------------------------------------------
A0A337S3J9_MCL1-03      ccgagggccccgacgtcaccgcgacccccccgaagctgctgttcttcgcg
                                                                          

A0A337S3J9_MCL1-01      gccacccgctgtgcgtcgccgcctgaaaagatggaaggcccagccgccga
Q7YRZ9_MCL1-01          gccacccgctgtgcgtcgccgcctgaagagatggaaggcccagccgccga
A0A337S3J9_MCL1-04      --------------------------------------------------
A0A337S3J9_MCL1-03      gccacccgctgtgcgtcgccgcctgaaaagatggaaggcccagccgccga
                                                                          

A0A337S3J9_MCL1-01      cgccatcatgtcgcccgaagaggagctagacgggtacgagccagaacctc
Q7YRZ9_MCL1-01          cgccatcatgtcgcccgaagaggagctagacgggtacgagccagaacctc
A0A337S3J9_MCL1-04      --------------------------------------------------
A0A337S3J9_MCL1-03      cgccatcatgtcgcccgaagaggagctagacgggtacgagccagaacctc
                                                                          

A0A337S3J9_MCL1-01      tggggaagcggccggctgtcctgcctttgctggagttggtcggggaggcc
Q7YRZ9_MCL1-01          tggggaagcggccggctgtcctgcctttgctggagttggtcggggaggcc
A0A337S3J9_MCL1-04      --------------------------------------------------
A0A337S3J9_MCL1-03      tggggaagcggccggctgtcctgcctttgctggagttggtcggggaggcc
                                                                          

A0A337S3J9_MCL1-01      agcagtggccccggcacagacggctcactgccctcgacgccacccccagc
Q7YRZ9_MCL1-01          agcagtggccccggcacagacggctcactgccctcgacgccacccccagc
A0A337S3J9_MCL1-04      --------------------------------------------------
A0A337S3J9_MCL1-03      agcagtggccccggcacagacggctcactgccctcgacgccacccccagc
                                                                          

A0A337S3J9_MCL1-01      agaggaggaggaggacgagttgttccggcagtcgctggagattatctctc
Q7YRZ9_MCL1-01          agaggaggaggaggacgagttgttccggcagtcgctggagattatctctc
A0A337S3J9_MCL1-04      --------------------------------------------------
A0A337S3J9_MCL1-03      agaggaggaggaggacgagttgttccggcagtcgctggagattatctctc
                                                                          

A0A337S3J9_MCL1-01      ggtaccttcgggagcaggcgaccggcgccaaggacgcgaaaccactgggc
Q7YRZ9_MCL1-01          ggtaccttcgggagcaggcgaccggcgccaaggacgcgaaaccactgggc
A0A337S3J9_MCL1-04      ----------------ggcgaccggcgccaaggacgcgaaaccactgggc
A0A337S3J9_MCL1-03      ggtaccttcgggagcaggcgaccggcgccaaggacgcgaaaccactgggc
                                        **********************************

A0A337S3J9_MCL1-01      gggtctggggcggccagccgaaaggcgttagagaccctccgacgggtcgg
Q7YRZ9_MCL1-01          gggtctggggcggccagccgaaaggcgttagagaccctccgacgggtcgg
A0A337S3J9_MCL1-04      gggtctggggcggccagccgaaaggcgttagagaccctccgacgggtcgg
A0A337S3J9_MCL1-03      gggtctggggcggccagccgaaaggcgttagagaccctccgacgggtcgg
                        **************************************************

A0A337S3J9_MCL1-01      ggacggcgtgcagcgcaaccacgagaccgccttccaaggcatgcttcgga
Q7YRZ9_MCL1-01          ggacggcgtgcagcgcaaccacgagaccgccttccaaggcatgcttcgga
A0A337S3J9_MCL1-04      ggacggcgtgcagcgcaaccacgagaccgccttccaaggcatgcttcgga
A0A337S3J9_MCL1-03      ggacggcgtgcagcgcaaccacgagaccgccttccaaggcatgcttcgga
                        **************************************************

A0A337S3J9_MCL1-01      aactggacatcaaaaacgaaaacgatgtcaaatctttgtctcgagtgatg
Q7YRZ9_MCL1-01          aactggacatcaaaaacgaaaacgatgtcaaatctttgtctcgagtgatg
A0A337S3J9_MCL1-04      aactggacatcaaaaacgaaaacgatgtcaaatctttgtctcgagtgatg
A0A337S3J9_MCL1-03      aactggacatcaaaaacgaaaacgatgtcaaatctttgtctcgagtgatg
                        **************************************************

A0A337S3J9_MCL1-01      gtccatgttttcagtgacggagtaacaaactggggcaggattgtgactct
Q7YRZ9_MCL1-01          gtccatgttttcagtgacggagtaacaaactggggcaggattgtgactct
A0A337S3J9_MCL1-04      gtccatgttttcagtgacggagtaacaaactggggcaggattgtgactct
A0A337S3J9_MCL1-03      gtccatgttttcagtgacggagtaacaaactggggcaggattgtgactct
                        **************************************************

A0A337S3J9_MCL1-01      tatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaag
Q7YRZ9_MCL1-01          tatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaag
A0A337S3J9_MCL1-04      tatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaag
A0A337S3J9_MCL1-03      tatttcttttggtgcctttgtggccaaacacttgaagagtataaaccaag
                        **************************************************

A0A337S3J9_MCL1-01      aaagctgcatcgaaccattagcagaaagcatcacagatgttcttgtaagg
Q7YRZ9_MCL1-01          aaagctgcatcgaaccattagcagaaagcatcacagatgttcttgtaagg
A0A337S3J9_MCL1-04      aaagctgcatcgaaccattagcagaaagcatcacagatgttcttgtaagg
A0A337S3J9_MCL1-03      aaagctgcatcgaaccattagcagaaagcatcacagatgttcttgtaagg
                        **************************************************

A0A337S3J9_MCL1-01      acaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtgga
Q7YRZ9_MCL1-01          acaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtgga
A0A337S3J9_MCL1-04      acaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtgga
A0A337S3J9_MCL1-03      acaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtgga
                        **************************************************

A0A337S3J9_MCL1-01      gttcttccatgtagaggacctagaaggtgg--------------------
Q7YRZ9_MCL1-01          gttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctgg
A0A337S3J9_MCL1-04      gttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctgg
A0A337S3J9_MCL1-03      gttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctgg
                        ******************************                    

A0A337S3J9_MCL1-01      -------agataaggcttga------------------------------
Q7YRZ9_MCL1-01          cttttgcaggtgttgctggagtaggagctggtttggcatatctaataaga
A0A337S3J9_MCL1-04      cttttgcaggtgttgctggagtaggagctggtttggcatatctaataaga
A0A337S3J9_MCL1-03      cttttgcaggtgttgctggagtaggagctggtttggcatatctaataaga
                               ** *   *** **                              

A0A337S3J9_MCL1-01      ---
Q7YRZ9_MCL1-01          tag
A0A337S3J9_MCL1-04      tag
A0A337S3J9_MCL1-03      tag
                           

© 1998-2020Legal notice