Dataset for CDS BCL2L1 of organism Salmo trutta

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A673Z4J6_BCL2L1-      ---atgtcttacagtaacagg---gaactggtggtgttttttataagcta
A0A674C4N2_BCL2L1-      ---atgtcttacagtaacagg---gaactggtggtgttttttataagcta
A0A674C337_BCL2L1-      atgatgacttacaacaacaga---gaactggtggtgtactatattaccta
A0A674C578_BCL2L1-      ------atgtgtattaacctatctgaactggtggtatactatattaccta
A0A674C578_BCL2L1-      attatgacttacaacaacaga---gaactggtggtatactatattaccta
                                 *  *  ***      *********** *  * *** * ***

A0A673Z4J6_BCL2L1-      tagactgtcccagaggaattattcatgttgtcaattggggctggagggtg
A0A674C4N2_BCL2L1-      taaactgtcccagagaaattatccatgttgtcagttggtgctggagggtg
A0A674C337_BCL2L1-      taaactatcacagagggactaccccttcaaccacatggagctcacggaag
A0A674C578_BCL2L1-      taaactatcacagagagactaccccttcaaccacattgggctcacagaag
A0A674C578_BCL2L1-      taaactatcacagagagactaccccttcaaccacattgggctcacagaag
                        ** *** ** *****  * **  * *     **  * * ***    *  *

A0A673Z4J6_BCL2L1-      caagtggacggactgagggagatgaggccattgcaaatgggtctgtgg--
A0A674C4N2_BCL2L1-      caagtgggcggactgagggggatgaagccattgcaaatgggtctttggga
A0A674C337_BCL2L1-      cccagaatcggactgaggggggacaggt----ggaagggggt--------
A0A674C578_BCL2L1-      ctcccagtcggactgaggggggacaggc----ggaagggggg--------
A0A674C578_BCL2L1-      ctcccagtcggactgaggggggacaggc----ggaagggggg--------
                        *       *********** *   * *     * **  ***         

A0A673Z4J6_BCL2L1-      -------ggaacagcagaa------------gcaacttggcaaag-----
A0A674C4N2_BCL2L1-      aacaacaggaacggcagaa------------gcaatttgggtaag-----
A0A674C337_BCL2L1-      -gctgcagtcataacatac------------gtcaacgggacgagtcccg
A0A674C578_BCL2L1-      -gcggcagtcacgacacaccccaacggcgcagcgaacgggacgagtcctg
A0A674C578_BCL2L1-      -gcggcagtcacgacacaccccaacggcgcagcgaacgggacgagtcctg
                               *  *   ** *             *  *   **   **     

A0A673Z4J6_BCL2L1-      --------------------------ccctcatctccacaggg------g
A0A674C4N2_BCL2L1-      --------------------------ccttcctctccacaggg------g
A0A674C337_BCL2L1-      ggactccaccaccacggcagtcacccccctcctcccctcggcggacagcg
A0A674C578_BCL2L1-      ggact---ccaccgcgacagtctcccccctcgtcccctcagcggacaatg
A0A674C578_BCL2L1-      ggact---ccaccgcgacagtctcccccctcgtcccctcagcggacaatg
                                                  ** ** ** ** * * *      *

A0A673Z4J6_BCL2L1-      ggcatggagccagtgaaagcagcactacgggactcagtggatgagtttga
A0A674C4N2_BCL2L1-      ggaattgaggcagtgaaagcagcactacgggactcagtggatgagtttga
A0A674C337_BCL2L1-      ggtctggatgcagtgaaagaggcattgcgggactctgccaacgagtttga
A0A674C578_BCL2L1-      ggcctggacgcagtgaaagaggcattgcgggactctgccaacgagtttga
A0A674C578_BCL2L1-      ggcctggacgcagtgaaagaggcattgcgggactctgccaacgagtttga
                        **  * **  *********  *** * ******** *   * ********

A0A673Z4J6_BCL2L1-      gctgcgctacacccgcgcctttagtgacctctcctcccagctccacatca
A0A674C4N2_BCL2L1-      gctgcgttacacccgcgccttcagtgacctctcctcccagctccacatca
A0A674C337_BCL2L1-      gctgcgttatgccagagcgttcagtgacctgtcctcccagctacacatca
A0A674C578_BCL2L1-      gctgcgttatgccagagcgttcagtgacctgtcctcccagctgcacatca
A0A674C578_BCL2L1-      gctgcgttatgccagagcgttcagtgacctgtcctcccagctgcacatca
                        ****** **  ** * ** ** ******** *********** *******

A0A673Z4J6_BCL2L1-      cccctgccacagcctaccacagctttgagagtgtgatggacgaagtgttc
A0A674C4N2_BCL2L1-      cccctgccacagcctaccacagctttgagagcgtgatggacgaagtgttc
A0A674C337_BCL2L1-      cgccgtccacagcctaccagagctttgagaacgtgatggacgaggtgttc
A0A674C578_BCL2L1-      cgccggccacagcctaccagagcttcgagaacgtgatggatgaggttttc
A0A674C578_BCL2L1-      cgccggccacagcctaccagagcttcgagaacgtgatggatgaggttttc
                        * **  ************* ***** ****  ******** ** ** ***

A0A673Z4J6_BCL2L1-      agggacggggtcaactggggtcgcgtggtgggtctgtttgctttcggcgg
A0A674C4N2_BCL2L1-      agggatggggtcaactggggtcgcgtggtgggcctgtttgctttcggcgg
A0A674C337_BCL2L1-      cgggacggtgtcaactggggacgggtggtgggcctgttttccttcggagg
A0A674C578_BCL2L1-      cgtgacggtgtgaactggggacgtgtggtgggcctgtttgccttcggagg
A0A674C578_BCL2L1-      cgtgacggtgtgaactggggacgtgtggtgggcctgtttgccttcggagg
                         * ** ** ** ******** ** ******** ****** * ***** **

A0A673Z4J6_BCL2L1-      ggccttgtgtgttgagtgtgttgagaaggatatgagcccactggtggcgc
A0A674C4N2_BCL2L1-      ggccctgtgcgttgagtgtgttgagaaggatatgagccacctggtgatgc
A0A674C337_BCL2L1-      ggccctctgtgtagaatgtgtggacaaggagatgaaccccttggtgggaa
A0A674C578_BCL2L1-      ggccctctgtgtagagtgtgtggagaaagagatgagcccactagtgggac
A0A674C578_BCL2L1-      ggccctctgtgtagagtgtgtggagaaagagatgagcccactagtgggac
                        **** * ** ** ** ***** ** ** ** **** **   * ***    

A0A673Z4J6_BCL2L1-      gcatcgcagactggatgaccacctacctggacaaccatatccagccctgg
A0A674C4N2_BCL2L1-      gcatcgcagactggatggccacctacctggacaatcatatccagccctgg
A0A674C337_BCL2L1-      ggatcacagactggatgaccgtctacctggacaaccacatccagccctgg
A0A674C578_BCL2L1-      ggattgcagactggatgactgtctacctggacaaccacatccagccctgg
A0A674C578_BCL2L1-      ggattgcagactggatgactgtctacctggacaaccacatccagccctgg
                        * **  *********** *   ************ ** ************

A0A673Z4J6_BCL2L1-      atccagagccaaggaggatgggaccgttttgcagagatctttggcagaga
A0A674C4N2_BCL2L1-      atccagagccaaggaggatgggaccgttttgcggagatcttcggcagaga
A0A674C337_BCL2L1-      atccagagccaaggaggatgggaccggtttgcagagatctttgggatgga
A0A674C578_BCL2L1-      atccagagccaaggaggatgggaccggtttgcagaaatctttgggaagga
A0A674C578_BCL2L1-      atccagagccaaggaggatgggaccggtttgcagaaatctttgggaagga
                        ************************** ***** ** ***** ** *  **

A0A673Z4J6_BCL2L1-      tgctgctgcagacgttcgacggtctcaggagagcataattaaatggctgc
A0A674C4N2_BCL2L1-      tgcagctgcagacgtccgacggtcccaggagagcttaagaaaatggctgc
A0A674C337_BCL2L1-      cgctgcagccgagagcaggaagtctcaggagagctttaagaagtggcttc
A0A674C578_BCL2L1-      cgctgcagctgagagcaggaagtcgcaggagagctttaagaagtggttgc
A0A674C578_BCL2L1-      cgctgcagctgagagcaggaagtcgcaggagagctttaagaagtggttgc
                         ** ** ** **     *   *** ********* * *  ** *** * *

A0A673Z4J6_BCL2L1-      tagctggggtgattctgctttcaggagtgctggtcggcactctcatcatg
A0A674C4N2_BCL2L1-      tagttggggtgatgctgctttcaggagtactggtcggcactctcatcatg
A0A674C337_BCL2L1-      tggcagggatgaccctggtcacaggagttgtcgttgggtcaatcttcgct
A0A674C578_BCL2L1-      tggcggggatgacgctggttaccggagtcatcgtagggtcactcattgct
A0A674C578_BCL2L1-      tggcggggatgacgctggttaccggagtcatcgtagggtcactcattgct
                        * *  *** ***  *** *  * *****  * ** **  *  ** *    

A0A673Z4J6_BCL2L1-      aagaaacgtcagtga
A0A674C4N2_BCL2L1-      aagaaatgccagtga
A0A674C337_BCL2L1-      cagaaacgcctgtga
A0A674C578_BCL2L1-      cagaaacgcctgtga
A0A674C578_BCL2L1-      cagaaacgcctgtga
                         ***** * * ****

© 1998-2021Legal notice