Dataset for CDS BAX of Organism Amphiprion ocellaris

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3Q1CKY3_BAX-01      atggcatcacacccgggaggaggcg-----accaaggaaatggcaa----
A0A3Q1CTC5_BAX-01      atgtc-tgacagccgagacgaggagaaatcaccgggagagcaggaacctc
                       *** * * *** *** ** **** *     ***  *  *   * **    

A0A3Q1CKY3_BAX-01      agaacagctcgtggaagtaggagctgctttgttaaaggacttcatttttg
A0A3Q1CTC5_BAX-01      agggcg--ccgtgggcggagaagatg--ttatt-gatgatcccatcttgg
                       **  *    *****  * ** ** **  ** **  * **   *** ** *

A0A3Q1CKY3_BAX-01      agcggg-----------ttcagcg---------------gcatggagaca
A0A3Q1CTC5_BAX-01      agcagggagcagtggtcctcagagggtatgtgattgaacgtataaacaca
                       *** **            **** *               * **  * ***

A0A3Q1CKY3_BAX-01      gtaaaactgtagtgacaagagcacagctggg-----tggaggagagctgg
A0A3Q1CTC5_BAX-01      g-aagaccctagtcggcacgtctcctctgaggatctgggaggaaggccgg
                       * ** **  ****    *   * *  *** *      ******  ** **

A0A3Q1CKY3_BAX-01      ttgaccca----agccat------aagaagc--tcggtcagtgcctgcag
A0A3Q1CTC5_BAX-01      atgaactacaggatccacaaattaaagaagtggtggatcag---cttctc
                        *** * *    * ***       ******   * * ****   ** *  

A0A3Q1CKY3_BAX-01      cagattggagatgagctggatggaaatgtggaactccagaggatgataaa
A0A3Q1CTC5_BAX-01      aagatagctgatgaactgaacaggaacgctgagctccagcgacttatcaa
                        **** *  ***** *** *  * ** *  ** ****** *  * ** **

A0A3Q1CKY3_BAX-01      tgattcctcactcagtcctacaaaaggcgtgtttctgaaagttgctgttg
A0A3Q1CTC5_BAX-01      ccaggttcagggaaactgtgctcaggacatcttcatgaaggtcgccagga
                         *          *    * *  * * * * **  **** ** **     

A0A3Q1CKY3_BAX-01      agatcttttcagatggaaaatttaactggggcagggtagttgcgctgttc
A0A3Q1CTC5_BAX-01      gcatctttgctgatggaa---ttaactggggtcgagtggtggctctcttt
                         ****** * *******   **********  * ** ** ** ** ** 

A0A3Q1CKY3_BAX-01      tactttgcctgtcgactcgtcattaaggctcttgtaacccaagttcctga
A0A3Q1CTC5_BAX-01      catctggcctacagacttatatacaaggctctgactaccaaccatttaga
                        *  * ****   ****  *    ********    *** *   *   **

A0A3Q1CKY3_BAX-01      tatcatcagaaccattattcattggaccatggactacctccgggaacatg
A0A3Q1CTC5_BAX-01      gaacatcagaatggttatcagctgggttctccaagtcattagagagcagc
                        * ********   ****    ***    *  *   * *  * ** **  

A0A3Q1CKY3_BAX-01      tgatcaactggatcagggagcaaggtggctgggaggg---tattcgttcc
A0A3Q1CTC5_BAX-01      tctatgcctggcttgtgcagcagggaggctgggagggggtgatccgt---
                       *      **** *   * **** ** ***********    ** ***   

A0A3Q1CKY3_BAX-01      cacttcggcactcccacatggcagacagtgggagttttcttggcaggcgt
A0A3Q1CTC5_BAX-01      ------agcttttctcgatggaggacagcagccatagtagcatcagtcgt
                              **  * *   ****  *****  *   *  *     *** ***

A0A3Q1CKY3_BAX-01      tctcaccactgttcttgtcattcgcaagatg------tga
A0A3Q1CTC5_BAX-01      actggtggcaacttttgtttatctcaggaggacacgctga
                        **     *   * ****   ** ** ** *      ***

© 1998-2020Legal notice