Dataset for CDS BCL-2-like of organism Amazona collaria

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A8B9FJB5_BCL2A1-      atggaaactgc---------------------------------------
A0A8B9FKI5_BCL2L1-      atgtgccccgtgcgcccggccctggcggcgcggactcgccggtttgcggc
A0A8B9GMI8_MCL1-01      atgttcgc----------gctcaagcggaaagcggtcatcggcct-----
                        ***    *                                          

A0A8B9FJB5_BCL2A1-      --------tgacttctactacgtttattatttagctc-------------
A0A8B9FKI5_BCL2L1-      cgagcgaggggcttcgggggtggggggggctgtgcccggtgcagggggtg
A0A8B9GMI8_MCL1-01      --------caacctctactgcgggggcagcccggccc-------------
                                   * **      *           ** *             

A0A8B9FJB5_BCL2A1-      -------------aagattatctgcaatatgtgcttc-------------
A0A8B9FKI5_BCL2L1-      cgagggtgaccccgcggttaccgtcacaccgggcccctctcggggctgcc
A0A8B9GMI8_MCL1-01      ------cgccgccgccctccccggcggcctgggccgc-----ggggtg--
                                         *   *  *     * **  *             

A0A8B9FJB5_BCL2A1-      --------aggagtcacatcttg----------------------gacca
A0A8B9FKI5_BCL2L1-      gtaacccttggcaacgccgcttgcccgcttccgccggccgccgttgggca
A0A8B9GMI8_MCL1-01      ------ctccgaggcgctgctgg---gctgcggcccggtcccgctgcgga
                                  *   * *  ** *                      *   *

A0A8B9FJB5_BCL2A1-      gccc-------------------aaaccaga-------------------
A0A8B9FKI5_BCL2L1-      acgccggcggaggggggcggggggagccgagctctttaacgggcggggcg
A0A8B9GMI8_MCL1-01      gccccg------------aggaggagctggacg-----------------
                         * *                    * *                       

A0A8B9FJB5_BCL2A1-      -----------------------gttgc---tcatgtcttgcgaaaca--
A0A8B9FKI5_BCL2L1-      ggggcggggctgcctccgcctccgctgcgcttcgggactggcggagcgcg
A0A8B9GMI8_MCL1-01      -----------------------gctgcgagccggagc---ccgagcgcg
                                               * ***    *    *   *  * *   

A0A8B9FJB5_BCL2A1-      -----------ttgcatcttcactgcaagatca-----------------
A0A8B9FKI5_BCL2L1-      gccgggccggtccgcagc--caccgcagcgccagagccgcctcccgcagc
A0A8B9GMI8_MCL1-01      gcc--------ccgcggcggccccgctgc-ccggcggcgcc-cccgacgc
                                     **  *  * * **     *                  

A0A8B9FJB5_BCL2A1-      --------------------------------------aactgaggag--
A0A8B9FKI5_BCL2L1-      ccggcccggcccggcccggcccgcagccgcctgcccgcacccggtgaggc
A0A8B9GMI8_MCL1-01      cctgc---gccaggcctcgctggagctcatcggccgctacctgcgggagg
                                                              * * *  *    

A0A8B9FJB5_BCL2A1-      -----------------------------gctctca--------------
A0A8B9FKI5_BCL2L1-      ccgggggctccctggggtccaggtcagatgctcccatcggcggtgcagaa
A0A8B9GMI8_MCL1-01      cggcgggc-----gaggcccagccc----gcgccca--------------
                                                     ** * **              

A0A8B9FJB5_BCL2A1-      --------------------------------------------------
A0A8B9FKI5_BCL2L1-      gaagagcagggtcgggagctgctgagtgccgatctgtgcgtgctccggac
A0A8B9GMI8_MCL1-01      -agaagctgttcccggggctg------------ctgtgcgggccc-----

A0A8B9FJB5_BCL2A1-      --------------gaccattc----------------------------
A0A8B9FKI5_BCL2L1-      catggactcattgagggcgtcccaggtgtgaaaatgtccagcagcaaccg
A0A8B9GMI8_MCL1-01      --------------gggcggcc----------------------------
                                      *  *   *                            

A0A8B9FJB5_BCL2A1-      --------------------------------------------------
A0A8B9FKI5_BCL2L1-      ggcgttagtgattgactttgtgtcctacaagctctcgcagaagggccaca
A0A8B9GMI8_MCL1-01      -------------------------------------ccgaggggcggcg

A0A8B9FJB5_BCL2A1-      -----------ctgga---------------cagaattgacattacctct
A0A8B9FKI5_BCL2L1-      gctggagccagctggaggaggaggatgagagcaggactgactttgcagct
A0A8B9GMI8_MCL1-01      gattcgg--ggctggagaaggcgctggaga----------------cgct
                                   *****                                **

A0A8B9FJB5_BCL2A1-      gtagctgttgc---caagagaattttcaatggtgtcat------------
A0A8B9FKI5_BCL2L1-      gaggaggtagagatggacggcgtcctcaatgggagcccctcctggcaccc
A0A8B9GMI8_MCL1-01      gcggaggctcgg--ggacagcgtcct--gcggaagcac------gagctc
                        *  *  *         *  *  *  *    **   *              

A0A8B9FJB5_BCL2A1-      ----------------------gga-------------agaaaaatttgc
A0A8B9FKI5_BCL2L1-      gcccgccagccacgtagtgaacggagctgccatgcaccggagcagcctcc
A0A8B9GMI8_MCL1-01      gcgttccag-------------gga------atgctccgg---aagctgg
                                              ***              *   *   *  

A0A8B9FJB5_BCL2A1-      tgat------------------------------ggaaatact-------
A0A8B9FKI5_BCL2L1-      aggtccacaacacagtccaagcggccgacgtgaggcaggcactgagagag
A0A8B9GMI8_MCL1-01      aaatccaga---------aggaggaggacct---gcaggcggtgcacgag
                           *                              * *     *       

A0A8B9FJB5_BCL2A1-      --------------------------------------------------
A0A8B9FKI5_BCL2L1-      gcgggggatgagttcgagctgaggtaccggcgggc--gttcagcgacctc
A0A8B9GMI8_MCL1-01      gtgg-----------------------ctgcgcgcttgttcagcgac---

A0A8B9FJB5_BCL2A1-      --------------------------------------------------
A0A8B9FKI5_BCL2L1-      acgtcccagctccacatcacccccggcaccgcgtaccagagctttgagca
A0A8B9GMI8_MCL1-01      --------------------------------------------------

A0A8B9FJB5_BCL2A1-      -------------------------------aactggggacgaattatga
A0A8B9FKI5_BCL2L1-      ggtggtgaacgaactcttccgcgatggagtgaactgggggcgcatcgtgg
A0A8B9GMI8_MCL1-01      -ggggtgacc---------------------aactggggccgggtggtga
                                                       ******** **  *  ** 

A0A8B9FJB5_BCL2A1-      ccatatttacatttggaggtcttctcactaagaagcttcaagagcat---
A0A8B9FKI5_BCL2L1-      ctttcttctccttcgga------ggagccttg-tgtgtggagagcgtcga
A0A8B9GMI8_MCL1-01      cgctcatctccttcggggccttcgtcgccaag-cacctgaagagcatccg
                        *  *  *  * ** **           *   *     *  ***** *   

A0A8B9FJB5_BCL2A1-      ---ggagttca---------------gctcactggagaggaaaaggagca
A0A8B9FKI5_BCL2L1-      caaggagatgcgggtattggtgggacgcattgtgtcttgga---------
A0A8B9GMI8_MCL1-01      gcaggagcagt--gcatcg-------gctccctggcaggga---------
                           ****                   **    **    ***         

A0A8B9FJB5_BCL2A1-      gatttcgtatttcatcacagagtacatcataaacaataaagccgaatgga
A0A8B9FKI5_BCL2L1-      -----------tgaccacctacttgaccgaccacctagatccc---tgga
A0A8B9GMI8_MCL1-01      -----------tcatcacggacgcgctcctctcctccagtcgcgagtggc
                                   * * ***  *      *     *        *   *** 

A0A8B9FJB5_BCL2A1-      tagatgcaaacggtggctgggaaa-----atggcttcctaa---------
A0A8B9FKI5_BCL2L1-      tccaggagaatggcggatgggagcgctttgtggacctctatgggaacgat
A0A8B9GMI8_MCL1-01      tgctgagccagggaggttgggagggctttgtggacttcttt---------
                        *        * ** ** *****        ***    **           

A0A8B9FJB5_BCL2A1-      ------------------------------------------------cg
A0A8B9FKI5_BCL2L1-      gctgctgccgaggcgctgaggccaaggcagcacttcagccaccagctccc
A0A8B9GMI8_MCL1-01      --------------------------------------------------

A0A8B9FJB5_BCL2A1-      aagtttgaaag-----------aagatcacgactgt-ctttctccaaaat
A0A8B9FKI5_BCL2L1-      acactggggggccccgggcagcgggggca-gaaggtgccccccccccagg
A0A8B9GMI8_MCL1-01      -cacgtggaagacctggaaggcagcatcaggaatgtgc------------
                              *   *                ** **  ** *            

A0A8B9FJB5_BCL2A1-      tacagccatgtt-----------------catagctgtttttaccttgtt
A0A8B9FKI5_BCL2L1-      ctcctccaggtcacttggaagagaataaacagacttatttttgcatgtgt
A0A8B9GMI8_MCL1-01      -----tgatggcgtttgcaggcg-----------------tggctggact
                               * *                              *  *     *

A0A8B9FJB5_BCL2A1-      cagagagtact----------------actga-----
A0A8B9FKI5_BCL2L1-      gagtgcgtgcgtgtgtgtagatgtgtcactaatataa
A0A8B9GMI8_MCL1-01      gggagcgagcttg-gcgtacatgatccggtga-----
                          * * *  *                   * *     

© 1998-2023Legal notice