Dataset for CDS BCL2L10 of organism all

[Download (right click)] [Alignment] [Repertoires]

113 sequence(s)

>gnl|bcl2dbcds|A0A3Q1GM98_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Acanthochromis polyacanthus GN=BCL2L10 (length=585 residues).
atgtcctgtgggctatggaaagagactgtggtcctggcagaggactacctgtccctgtgctgtgcaggcccacatcaagc
ccctccacctcccagcgagtcagccgctgccatgaggcgtctggcccaagacatggagaagcagcaccaggctcgcttcc
actccctcactcaggccttcctgaggcagtgcgggccggacttctgctccagcctcaggatggtgatggaggagctggtg
gaagatggacacttgaactgggggagggttgtttcccttttcacctttactggggtgctggccagacagctgctggagca
gaaggacacaaagccggggctggaccccgggaagcgacaggaactgggacagaggcctgtaaactgcagaggactggcag
agaccatagctgattacttgggagaggagaagaaagactggctgttggagaatgatggatgggaaggcttctgtaagttc
tccctcagtgccagaaaggcgagtcaggacttgtccatgaagacagcgctgtttgctgctgccggtgtcggcctcgctgg
actcaccttcctcctggtgcgctaa
>gnl|bcl2dbcds|A0A7N5JVN3_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Ailuropoda melanoleuca GN=BCL2L10 (length=582 residues).
atggcggacgcgttgagggagcgcacggcgcggctgctgaccgactacctggagtactgcgcccgggagcccggcacccc
tgcgcgggcgccgtccacgcccgaggccgcggtgctgcgttcggtggccgcccaggtacagcagcgtcacgagcgcttct
tgtccgattaccgcggctacggcggcaaccgcgtggagctggtggctcaggtggagcgggagatactcgcccacccccag
cccctaagctggggccgtgtggtggcgctcttgaccttcgcgggcacactgctggagagatcgccgtcggggacctactc
gaacctggggccggaccaggaactggagctgggggagtgggaggccggcgtccgccaggactgccggcacctggtggact
tcctctgcaatcggctcacgggacagcatcgcgcctggctggaggcgcacgacggctgggatggcttttgtctcttcttc
acacccatgctgccgtcgtcttggaaaagactgctggcccaggctcttctgtcctgcttcacagcggtgatcttaatcta
cttctggaaaaggttattgtga
>gnl|bcl2dbcds|A0A3Q0S9R1_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Amphilophus citrinellus GN=BCL2L10 (length=576 residues).
atggtccctgggctgtggaaagaaaccctgggtttggctgaggactacctgtctctgtgctgcacaagtccacatcaagt
ccctccacctcccagcgagtcagccgctgccatgagacgtctgggccaggatattgagcggcagcaccaggctcgctttg
acaaccttgctcagaccttcctgaggcattgcgggccggatcactgctctagcctcaggaaggtgatggaggagctggtg
ggagacggacacttgaactgggggagggttgtttccctttttgcttttactggggtgctagccagaaagaggctggagca
gaagccagggctggaccctgggcaacagcaggaactgggacaggagcccataagctgcagggagctggcagagaccatag
ctgattacctgggggaagagaagaaagactggctcttggacaatgatggatgggagggtttctgtaagtactcccgcagt
gccagagaggtgagccaggactcttccatgaagaccgcgctgtttgctgctgctggcgtcggcctggccgggcttacttt
ccttttggtgcgctag
>gnl|bcl2dbcds|A0A3Q1D2L0_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Amphiprion ocellaris GN=BCL2L10 (length=585 residues).
atgtcctgtgggctatggaaagagaccttggtcctggcagaggactacctgtccctgtgctgtgcaagcccacatcaagc
ccctccacctcccagcgagtcagcggctgccatgaggcgtctggcccaggacatggagaagcagcaccaggctcgcttcc
actccctcactcagaccttcctgaggcagtgcgggccggacctctgctccagcctcaggaaggtgatggaggagctggtg
ggagatggacacttgaactgggggagggttgtttcccttttcacctttactggggtgctggccagacagctgctggagca
gaaggacacaaagctggggctggaccccgggaagcagcaggaactgggacaggggcccgtaaactgcagagaactggcag
agaccatagctgattacctgggagaggagaagaaagactggctgttggagaatgatggatgggaaggcttctgtaaattc
tccctcagtgccagagaggtgagtcaggacttgtccatgaagacagcgctgtttgctgctgcgggtgtcggccttgctgg
gctcaccttcctcctggtgcgctaa
>gnl|bcl2dbcds|A0A3P8RL82_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Amphiprion percula GN=BCL2L10 (length=585 residues).
atgtcctgtgggctatggaaagagaccttggtcctggcagaggactacctgtccctgtgctgtgcaagcccacatcaagc
ccctccacctcccagcgagtcagcggctgccatgaggcgtctggcccaggacatggagaagcagcaccaggctcgcttcc
actccctcactcagaccttcctgaggcagtgcgggccggacctctgctccagcctcaggaaggtgatggaggagctggtg
ggagatggacacttgaactgggggagggttgtttctcttttcacctttactggggtgctggccagacagctgctggagca
gaaggacacaaagccggggctggaccccgggaagcagcaggaactgggacaggggcccgtaaactgcagagaactggcag
agaccatagctgattacctgggagaggagaagaaagactggctgttggagaatgatggatgggaaggcttctgtaaattc
tccctcagtgccagagaggtgagtcaggacttgtccatgaagacagcgctgtttgctgctgcgggtgtcggcctcgctgg
gcttaccttcctcctggtgcgctaa
>gnl|bcl2dbcds|A0A3Q1IAB0_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Anabas testudineus GN=BCL2L10 (length=732 residues).
atgttccaactctcatggggactttttcttctggaggcggagtcagcggataaatgtgcggacgctgaggggaaactgcg
agtgcaccgaggatctccttccgccgtccgtatgtgcagagagcagactgatatcgctgggaggaaaatgtcgtgtgggc
tgtggaaagacaccctggctctggcagaggactacctgtccctgtgctgcaccagcccttggccagcccctccacctccc
agcgagtcagccgctgccatgagacgtctggcccaggacatggagaagcagcatcaggttcgcttccactccctagctca
gactttcctgaagcagtgcgggccggacccctgctccagcctcaggaaggtgatggaggagctggtgggagatggacaca
tgaactgggggagggttgtttcccttttcaccttcactggggtgctggccagacagatgctggagcagaaggacaagaag
ccggggctggaccttgggaaggggcaggaactaggacaggagcctggacaatgtaggggactggcagagaccatagctga
ttacctgggagaagagaagaaagactggctgctggagaatgatggatgggaggggttctgtaagttctcctgcagtgcca
gagaagtgagccaggactcctccatgaagagagcgctgtttgctgctgctggtgtgggtcttgcgggactcaccttcctc
ctggtgcgctag
>gnl|bcl2dbcds|A0A2K5F974_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Aotus nancymaae GN=BCL2L10 (length=642 residues).
atggctgacccgctgcggcagcgcaccgagcggctggtggcggactacctggagtactgctcccaggagcctggcacccc
cgagtcgccgccgtccacggccgaggccgctgtgctgcgcgccatggccgccggtgtacggaaactctaccggtccttct
tctccgcctacctcggctacccggggaaccgcgtcgagctggtggcgaggatggcggaggccctgctctccgacagtccc
ggccccacctggggcaacgtggtgatgctcctggccttcgcggggacgctgctagagagggggccgctggtgaccgcccg
gtggaagaagtggggcttccagtcgcggctgaaggagccggagggcgacgtcgcccgggactgccagcgcctggtggcct
tgctgagctcgcggctcgtggggcagcaccgtgcctggctggaggctcagggcggctgggtgagcatgcggagggggaca
cgggcctcccgagtagctgggaatataggatggcttttgttacttcttcaggacctcctcctcgctggcattatggagaa
aactgctggtccaggttttcctgtcatggttgttaacagcagcattcatctacttctggacacgataattaggagttttt
aa
>gnl|bcl2dbcds|A0A3P8PVZ8_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Astatotilapia calliptera GN=BCL2L10 (length=822 residues).
atgatttatggattatttgtcacccttttttgtaccataccaaaccatgaccacacttccgctggttattccgtggcggt
ggtgtcttctttccacagtccacacgacgttcccagcacaaaaatcatgtcgagaggcggagtcacgcattctgcatcag
ctgaagggaagactcaactgtaccgacgctctccttccgccgtctgtatgtgcagagagcagtctgatatcgctgggagg
aaaatgaaattctgtgggctgtggaaagagaccctggttttggccgaggactacctgtccttttgctgcacgagtccaca
tcaagcccctccacctcccagcgaatcagccgctgccatgaggcgtctaggctgggacatcgaaagacagcaccaagctc
gcttcgacaacctcgctcagaccttcctggtgcagtgtggaccggaccactgcctcagcctcagaaaggtgatgaaggag
ctggttggagatggacacttgaactgggggagggttgtttctcttttcgcctttactggagtgctggccagaaagatcct
ggagcagaagccggggctggaccctcgtcaacagcaggaactgggacaggagcccatgagctgcagaaggctggcagaga
ccatagctgattacctgggagaagagaagaaagactggctgttggataatgatggatgggaaggcttctgtaagttctcc
cgcagtgccagagaagtgagccaggactcatccatgaagaaagcgctgtttgctgccgccggtgtcggccttgctgggct
taccttcctcttggtgcgctag
>gnl|bcl2dbcds|A0A4W2C0F3_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Bos indicus GN=BCL2L10 (length=576 residues).
tcagctgactcacttcattccatggtggacccgtttagggagcgcaccgcccggctgctgatggactacctggagttctg
cgcccgggagccgggcactccagttcctgcgccgtccacgcctgaggctgccgtgctgcgccacgtggccgcacgtatcc
aggaagcaaatcgaaatgtcttgcccctataccgccgctgccgcaggcaccgcgtcgagctggtggccaggatggcgcag
aggctactcgacgaagaccctggccccagctggggccgcgtggcctcactcgtgaccttcgcggggtcgctgctggagag
gccgccgcagactacccgacggcagaagagagacgacgacggcgttagcagggactgtcggctcctggtggcccttctgt
gtgctcagttctgcgaaaggcaccgcgcctggctgatggctaacggcggctgggatggattttgtctctttttcagccag
tcattccagccatcttgggaaagacagctggtctggtttttcctcgcatactggacagcaataatcataatctacttctg
gataaaattattgtga
>gnl|bcl2dbcds|A0A4W2FG99_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Bos indicus GN=BCL2L10 (length=576 residues).
tcagctgactcacttcattccatggtggacccgtttagggagcgcaccgcccggctgctgatggactacctggagttctg
cgcccgggagccgggcactccagctcctgcgccgtccacgcctgaggctgccgtgctgcgccacgtggccgcacgtatcc
aggaagcaaatcgaaatgtcttgcccctataccgccgctgccgcaggcaccgcgtcgagctggtggccaggatggcgcag
aggctactcgacgaagaccctggccccagctggggccgcgtggcctcactcgtgaccttcgcggggtcgctgctggagag
gccgccgcagactacccgacggcagaagagagacgacgacggcgttagcagggactgtcggctcctggtggcccttctgt
gtgctcagttctgcgaaaggcaccgcgcctggctgatggctaacggcggctgggatggattttgtctctttttcagccag
tcattccagccatcttgggaaagacagctggtctggtttttcctcgcatactggacagcaataatcataatctacttctg
gataaaattattgtga
>gnl|bcl2dbcds|A0A8B9Y853_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Bos mutus grunniens GN=BCL2L10 (length=699 residues).
atgcgagaaggggcggggcgtcggcaggcccagaaaacaggccggggtcggacccccggtagaggcggagccatggtgga
cccgtttagggagcgcaccgcccggctgctgatggactacctggagttctgcgcccgggagcccggcactccagctcctg
cgccgtccacgcctgaggctgccgtgctgcgccacgtggccgcacgtatccaggaagcaaatcgaaacgtcttgccccta
taccgccgctgccgcaggcaccgcgtcgagctggtggccaggatggcgcagaggctactcgacgaagaccctggccccag
ctggggccgcgtggcctcactcgtgacctttgcggggtcgctgctggagaggccaccgcagacgacccgacggcaggaga
agagagacgacgacggcgttagcagggactgtcggctcctggtggcccttctgtgtgctcagttctgcgaaaggcaccgc
gcctggctgatggctaacggcggctgggatggattttgtctcttcttcagccactcattccagccatcttgggaaagaca
gctggtctggtttttcctctcatactggacagcaataatcataatctacttctggataaaattatcttttcttcacatag
gtcctgtgttcttgccagacgtattccagctctttgacttacgtcaccattgggaatag
>gnl|bcl2dbcds|A0A8B9Y853_BCL2L10-02 BCL2-like 10 gene OS=[Eukaryota] Bos mutus grunniens GN=BCL2L10 (length=699 residues).
atgcgagaaggggcggggcgtcggcaggcccagaaaacaggccggggtcggacccccggtagaggcggagccatggtgga
cccgtttagggagcgcaccgcccggctgctgatggactacctggagttctgcgcccgggagcccggcactccagctcctg
cgccgtccacgcctgaggctgccgtgctgcgccacgtggccgcacgtatccaggaagcaaatcgaaacgtcttgccccta
taccgccgctgccgcaggcaccgcgtcgagctggtggccaggatggcgcagaggctactcgacgaagaccctggccccag
ctggggccgcgtggcctcactcgtgacctttgcggggtcgctgctggagaggccaccgcagacgacccgacggcaggaga
agagagacgacgacggcgttagcagggactgtcggctcctggtggcccttctgtgtgctcagttctgcgaaaggcaccgc
gcctggctgatggctaacggcggctgggatggattttgtctcttcttcagccactcattccagccatcttgggaaagaca
gctggtctggtttttcctctcatactggacagcaataatcataatctacttctggataaaattatcagccaacatggacc
cagccaagcttgtcagcagccaggggaataacatctgtgtggataaaaagccagcctag
>gnl|bcl2dbcds|A0A4W2C0F3_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Bos indicus GN=BCL2L10 (length=576 residues).
tcagctgactcacttcattccatggtggacccgtttagggagcgcaccgcccggctgctgatggactacctggagttctg
cgcccgggagccgggcactccagttcctgcgccgtccacgcctgaggctgccgtgctgcgccacgtggccgcacgtatcc
aggaagcaaatcgaaatgtcttgcccctataccgccgctgccgcaggcaccgcgtcgagctggtggccaggatggcgcag
aggctactcgacgaagaccctggccccagctggggccgcgtggcctcactcgtgaccttcgcggggtcgctgctggagag
gccgccgcagactacccgacggcagaagagagacgacgacggcgttagcagggactgtcggctcctggtggcccttctgt
gtgctcagttctgcgaaaggcaccgcgcctggctgatggctaacggcggctgggatggattttgtctctttttcagccag
tcattccagccatcttgggaaagacagctggtctggtttttcctcgcatactggacagcaataatcataatctacttctg
gataaaattattgtga
>gnl|bcl2dbcds|A0A4W2FG99_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Bos indicus GN=BCL2L10 (length=576 residues).
tcagctgactcacttcattccatggtggacccgtttagggagcgcaccgcccggctgctgatggactacctggagttctg
cgcccgggagccgggcactccagctcctgcgccgtccacgcctgaggctgccgtgctgcgccacgtggccgcacgtatcc
aggaagcaaatcgaaatgtcttgcccctataccgccgctgccgcaggcaccgcgtcgagctggtggccaggatggcgcag
aggctactcgacgaagaccctggccccagctggggccgcgtggcctcactcgtgaccttcgcggggtcgctgctggagag
gccgccgcagactacccgacggcagaagagagacgacgacggcgttagcagggactgtcggctcctggtggcccttctgt
gtgctcagttctgcgaaaggcaccgcgcctggctgatggctaacggcggctgggatggattttgtctctttttcagccag
tcattccagccatcttgggaaagacagctggtctggtttttcctcgcatactggacagcaataatcataatctacttctg
gataaaattattgtga
>gnl|bcl2dbcds|E1B9B3_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Bos taurus GN=BCL2L10 (length=747 residues).
atgactgaaggcggagccatggtggacccgtttagggagcgcaccgcccggctgctgatggactacctggagttctgcgc
ccgggagccgggcactccagctcctgcgccgtccacgcctgaggctgccgtgctgcgccacgtggccgcacgtatccagg
aagcaaatcgaaacgtcttgcccctataccgccgctgccgcaggcaccgcgtcgagctggtggccaggatggcgcagagg
ctactcgacgaagaccctggccccagctggggccgcgtggcctcactcgtaaccttcgcggggtcgctgctggagaggcc
accgcagacgacccgacggcaggagaagagagacgacgacggcgttagcagggactgtcggctcctggtggcccttctgt
gtgctcagttctgcgaaaggcaccgcgcctggctgatgactaacggcggctgggtgagcgcgaaggacgcggggctggtg
ggcagcctgggacgcgcccacgctgccggatggattttgtctcttcttcagccactcattccagccatcttgggaaagac
agctggtctggtttttcctctcatactggacagcaataatcataatctacttctggataaaattatcgtgagttctaaaa
ttcttatttctacctgcctaactctgagcaaccaagcaaaattgaaatgtgaaagaccaaatcagagtaaaccaccttcc
gagacatttttatctgcattcatgtaa
>gnl|bcl2dbcds|F1MV39_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Bos taurus GN=BCL2L10 (length=564 residues).
gttgctgatggacaggaaagcctggtggagcgcaccgcccggctgctgatggactacctggagttctgcgcccgggagcc
gggcactccagctcctgcgccgtccacgcctgaggctgccgtgctgcgccacgtggccgcacgtatccaggaagcaaatc
gaaatgtcttgcccctataccgccgctgccgcaggcaccgcgtcgagctggtggccaggatggcgcagaggctactcgac
gaagaccctggccccagctggggccgcgtggcctcactcgtgaccttcgcggggtcgctgctggagaggccgccgcagac
tacccgacggcagaagagagacgacgacggcgttagcagggactgtcggctcctggtggcccttctgtgtgctcagttct
gcgaaaggcaccgcgcctggctgatggctaacggcggctgggatggattttgtctctttttcagccagtcattccagcca
tcttgggaaagacagctggtctggtttttcctcgcatactggacagcaataatcataatctacttctggataaaattatt
gtga
>gnl|bcl2dbcds|F7CT87_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Callithrix jacchus GN=BCL2L10 (length=579 residues).
atggctgacccgctgtggcagcgcaccgagcagctggtgacggactacctggagtactgctcccgggagcctggcacccc
cgagtcgccgccgtccaccgccgaggccgctgtgctgcgcgccgtggccgccagtgtgcggaaactctaccggtctttct
tctccgcctacctcggctaccccgggaaccgcgtcgagctggtggcgaggatggcggaggccctgctctccgacagtccc
ggccccacctggggcaacgtggtgatgctcctggccttcgcggggacgctgctagagagggggccgctggtgaccgcccg
gtggaagaagtggggcttccagtctcggctgaaggagccggaaggcgacgtcgcccgggactgccagcgcctggtggcct
tgctgagttcgcggctcgtggggcagcaccgtgcctggctggaggctcagggcggctgggatggcttttgttacttcttc
aggacctcctccttgctggcattatggagaaaagtgctggtccaggttttcctgtcatggttgttaacagcagtattcat
ctacttctggacacgataa
>gnl|bcl2dbcds|A0A8C0XBQ2_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Castor canadensis GN=BCL2L10 (length=567 residues).
atggcggacccgctgcgggagcgcaccgagcggctgctgaccgactacctgcagtactgcgcccgggagcccgagccggg
cgcccccgagccgcccccgtccacgcccgaggccgccgtgctgcgcgccgccgccacccggttacggcgtcgccactggg
ccttcttctcccgctacatcggctaccagggcaatcgcgtcgagctgatggcgcggatggccgaagctacgttctccgac
aaccgcggcctcaactggggccgcgtagtgacgctcgcggccttcgcggggacgctgctggagagagggccgtcggtggt
cgccgagtggaagacgcgccacgaagttgcccgggactgtccgcgcctggtggccttgctgtgcgctcggctcgtgggac
agcaccgtgcctggctggaggctcaaggcggctgggatggcttttgtcagttcttcaggacacccttaccactcactttt
tggagaagacggttgatctggactttcctgtcatgctttttagcaacggccttaatgtatttctggacacagttacataa
gttctaa
>gnl|bcl2dbcds|A0A2K5MMZ4_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Cercocebus atys GN=BCL2L10 (length=585 residues).
atggctgacccgttgcgggagcgcaccgagcggctcctggccgactatctggggtgctgcgcccgggaacccggcacccc
tgagccgaggccgtccacgcccgaggccgccgtgctgcgctcagcagccgccaggttacggcagctccaccggtccttct
tctccgcctaccgcggctaccgcgggaaccgcgtcgagctggtggcgctgatggcggaggccgtgctctccgacagcccc
ggccccacctggggcagggtggtgtcgctggtgaccttcgcggggacgctgctggagagagagccgctggtgacagcctg
gtggaagaagcggggcttccagccgcggctgaaggagcaggagggcgacgtcgcccgggactgccagcgcctggtggcct
tgctgagctcgcggctcgcggggcagcaccgcgcctggcttcaggctcagggcggctgggatggcttttgtcacttcttc
aggagcccctttccgctggctttttggagaacactgctgatccaggctttcctggcatgcttgttagcaacagccttcgg
ttatctctggacacgattattatga
>gnl|bcl2dbcds|A0A0D9RG38_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Chlorocebus sabaeus GN=BCL2L10 (length=582 residues).
atggctgacccgttgcgggagcgcaccgagcggctcctggccgactatctggggtgctgcgcccgggaacccggcacccc
tgagcccaggccgtccacgcccgaggccgccgtgctgcgctccgcggccgccaggttacggcagctccaccggtccttct
tctccgcctacctcggctaccccgggaaccgcgtcgagctggtggcgctgatggcggacgccgtgctctccgacagcccc
ggccccacctggggcagggtggtgtcgctggtgaccttcgcggggacgctgctggagagagagccgctgatgacagcctg
gtggaagaagcagagcttccagccgcggctggagcaggagggcgacgtcgcccgggactgccagcgcctggtggccttgc
tgagctcgcggctcgcggggcagcaccgcgcctggcttcaggctcaaggcggctgggatggcttttgtcacttcttcagg
agcccctttccgctggctttttggagaaaactgctgatccaggctttcctggcatgcttgttagcaacagccttcggtta
tctctggacaagattattatga
>gnl|bcl2dbcds|A0A2K5K3B0_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Colobus angolensis palliatus GN=BCL2L10 (length=615 residues).
atggctgaccagttgcgggagcgcaccaacgtggctgacccgttgcgcgagcgcaccgagcggctgctggccgactatct
ggggtgctgcgcccgggaacccggcacccccgagccgaggccgtccacgcccgaggccgccgtgctgcgctccgcggcgg
cccgattacggcagctccatcggtccttcttctccgcctacctcggctaccccgggaaccgcgtcgagctggtggcgctg
atggcggaggccgtgctctccgacagccccggccccacctggggcagggtggtgtcgctggtgaccttcgcggggacgct
gctggagagagagccgctggtgacagcctggtggaagaagcggagcttccagccgcggctgaaggagcaggagggcgacg
tcgcccgggactgccagcgcctggtggccttgctgagctcgcggctcgcggggcagcaccgcgcctggcttcaggctcag
ggcggttgggatggcttctgtcacttcttcaggaccccctttccgctggctttttggagaaaactgctgatccaggcttt
cctggcatgcttgttaacaacagccttcggttatctctggacacgattattatga
>gnl|bcl2dbcds|A0A8C2MSB6_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Cricetulus griseus GN=BCL2L10 (length=522 residues).
atggacgacccgctgctggaacgcactagacggctgctgactgactacttgatgttctgcgcacgggagccagatgaacc
cgagccactgcccaggtcggtcgaggccgccttgctgcgctccgtggcagagcagttccaagaacagcaccacttttttt
tctcctccttctacggctacaagggcaaccgtgtgctgctgatgacacagatggcagatgcggtgctctctgatagcgaa
ggcttcaactggggccgccttgtgatgctcttggccttcgcggggacaattgtgagtcaagagcagataaatgtgcttct
agactgccaactcatagtggacttgctgtgcgatcggatcctgggacagcatcgctcctggctggaggctcacggtggct
gggatggcttttaccacttcttttcgagccacttaccactcgatttttggaggagtctgctgatcaagacttttctatac
tgggtctttgcaacggccatgctgtttatctggaaaagatta
>gnl|bcl2dbcds|A0A8C3G7A6_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Cyclopterus lumpus GN=BCL2L10 (length=579 residues).
atgtcgtgcgggctgtggaaagagaccttggctctggcagaggactacctgtacctgtgctgcacaagcccacggccagc
ccctccacctcccagcgagtcagccactgccatgaggcgcctggcccaggacatggagacgcagcaccaggctcgcttcc
actccctcgctcagaccttcctgaggcagtgcgggccggacccctgctccagcctcaggaaggtgatagaggagttggtg
ggagacggacacttgaactgggggagggttgtttcccttttcacctttactggggtgctggccaggcagctgctggagca
gaatggcacaaagctggggctggaccctgggcaggaactagaacaggagtccggaaactgcaggggactggcggagacca
tagctgattacctgggagaggagaagaaagactggctgctggagaatgatggatgggaggggttctgcaagttctcccgc
agtgccagagaagtcggccaggactcgtccatgaagacggcgctgtttgctgctgctggtgtgggcctcgctggactcac
cttcctcctagtgcgctag
>gnl|bcl2dbcds|A0A3P8W7K5_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Cynoglossus semilaevis GN=BCL2L10 (length=654 residues).
atgtgcaactcagcgtctccttccgccgtctctacgagctctgagcagtctgatatcgctgggaggaaaatgtcatgtgg
gctgtggaaagagaccctggctgtggcagaggactacctgtccctctgctgttcaagcccccggccagcccctccacctc
ccagcgagtcagccgctgccatgagacacctggcccaggacatggagaagcagcaccaagctcgcttccagacgttgtct
cagtctttcctgaggcaatgtggctctgagccctgtgtgtgtcttaggaaggttatggaagagctggtaggagacggaca
cttgaactgggggagagttgtttccattttcacctttactggggttctggccaaacagctgttggtccagaagggtttaa
agccggggcaggaacccgaggcagggcaggaactgggaccggagcctggaacctgcagggaactggcagagaccattgct
gattatctgggagaagagaagaaagcgtggcttttggagaatggtggatgggaggggttctgtgagttctctcacagtgc
cagagagctgagccaggactcgtccatgaagaccgctctgtttgctgctgctagtgttggccttgctggactcaccttcc
tcctggtgcgctga
>gnl|bcl2dbcds|A0A3Q2GL87_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Cyprinodon variegatus GN=BCL2L10 (length=621 residues).
atgtgcagagagccgttacatatcactgggaggaaaatgtcctgtgggctgtggaaagagaccgtggctgtcgcagagga
ttacatgcgcctgcgctgctccagcccgctcccagccccgccacctcccagtgagcccgccgctgccatgaggcgcctgg
cccaggacatggagacccagcaccaggctcgtttccacaccctggcccagagcttcctgaggcacagcgggacggacctc
tgctccagcctcaggaaggtgatggacgagatggtgggggacggactctttaactgggggagggtcgtatccctctttac
ctttgccggcgtgctggccagacagctgcaggagcaaacgggcaaaaacccggggctggatcctgggaggcagcaggaac
tgcaaacggagcccgtaagctgccgggcgctggcagagaccatcgccgattatctggagacgcacaaaaaagactggctg
caggaaaataatggatgggatgggttctgtaactacgcccgcaacgccagagaagtcagccaggactcctccatgaagac
ggcgctggttgctgttgccggagtcggcatcgctggactcaccttcctcctggtgcgctag
>gnl|bcl2dbcds|A0A8C4HJC9_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Dicentrarchus labrax GN=BCL2L10 (length=591 residues).
atgtgcagagagcagtctgatatcgctgggaggaaaatggcatgcgggctgtggaaagagaccctggctctggcagagga
ctacctgtccctgtgctgcacaagcccccagccagcccctcaacctcccagcgagtcagccgctgccatgaggcgcatgg
cccaggacatggagacgcagcaccaggctcgctttcagtccctggctcagaccttcctgaggcagtgcgggccggacccc
tgctccagcctcaggagggtgatggaggagctggtgggagacggacacttgaactgggggagggttgtttccattttcac
ctttactggggtgctggccagactgctgctggagcagaaggacacaaagccggggctggaccctggaagatgcagtggac
tggcggagaccatcgctgattacctgggagaggagaagagagagtggctgctggagaatgacggatgggaggggttctgt
aagttctgccgcagtgccagagaagtgagtcaggactcgtccatgaagacagcgctgtttgccgctgctggcgtgggcct
cgctggactcaccttcctcctggtgcgctag
>gnl|bcl2dbcds|A0A665VTJ8_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Echeneis naucrates GN=BCL2L10 (length=579 residues).
atgtcatgtggggtgtggaaagagaccttggttgtggcagaggactacctatacctttgctgcacaaagccacagccagc
acccccacctcccagcgaatcagccgctgccatgaggaccgtggcccaggacatggaggcgcagcaccaggctcgcttcc
actcccttgttcagaccttcctgaagcagtctgggcaggacccctgtggcagcctcaggaaggtgatggaggagctggtg
ggagatggacacttgaactgggggagggtggtttccattttcacctttactggggtgctggccagacagctgctggagca
gagtggcatgaatccggggctggaccctgggaaaaaactgggacaggggcctggactctgcaggggactggcggagacca
tagctgattacctgggagaggagaagaaagactggctgctggagaatgatggatgggagggattctgtaagttctctcaa
agtgccagagaggtgagtcaggactcgtcaatgaagacggcgctgtttgctgctgctggcgtgggcctcgctggactcac
cttcctcctggtacgctag
>gnl|bcl2dbcds|F6ZPD4_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Equus caballus GN=BCL2L10 (length=561 residues).
gccgtggcggaggcgctgagggagcgcacggcgctactgctgatcgactacctgcagcgccgcgcccgggagccggccac
gcccgaggtggccgtgctgcgctgcgtggccgcccagatacagccccgcaaccagcgtgttctttcccgctaccgcggct
tccgcggggaccacgtcgggctggcggcacggatggcgcaggcgatcttcggagaccgccacgtccccagctggggccgc
gtggcggcgctcgtgaccctggcggggacgctgctggagagagccccgcggggaacctaccgaaagccgaagcggggcta
caagctggagctgagggagtggaaggccggcgtggaccgggactggccgcgcctggtggacttcctgtgcgcatggctca
aggggcggcaccgcgcctggctggaggctcactatggctgggatggcttttgtgacttctcactcacactgccagcttct
cagaggatactgctggtccggtttcttctgtcatgcttttcagcatcagtcttaatctacctctggacaaaattatcatg
a
>gnl|bcl2dbcds|A0A337RYG8_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Felis catus GN=BCL2L10 (length=579 residues).
atggctgacgcgttgagggagcgcacggcgcagctactgactgactacctggagtactgcgcccgggagcccggcagccc
cgcgcggacgccgtccacgcccgaggccgcggtgctgcgctacctggccgcccagatacggcagcgccaccagcgtttct
tgtcggcttaccgcggctaccgcggaaaccgcgtggaactggtggcgcggttggagcaggatttactctccaacccccaa
accctcagttggggccatgtggtagcgctcttgaccttcgcggggacgctgctggagagaccgccgccggggacctactt
gaacctgacgccggaccagcaacaggagctggagtgggagaccaacgttggccaggactgccagcacctggtggctttgc
tctgcaatcggctcaccggacggcatcgcgcctggctggaggctcacgacggctgggatggcttttgtctcttcttctca
cccatgctgccatcttcttggagaagactgctggtccaggctcttctgtcatgctttacagtaatgatcttaatctactt
ctggagaagattattgtga
>gnl|bcl2dbcds|A0A8C5CY11_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Gadus morhua GN=BCL2L10 (length=639 residues).
atgatggccagttgtctaacctgcatcaaaatggccatctcttccagaaacatgtcgtgtaggctgtggaaagagaccct
ggccctgtcagaggactacctgttgtcctgcactgcaagcacaggcacagccccgccgcctcccagcgagtcagccgcgg
ccatgaggggactggcccaggacatggagcggcagcactacgctcgcttccaggctctggcccagagcttcctggcccag
tgcgaggccgacgcatgcgccggcctccgcaaggtgatggaggagctggtgggagacggacagttgaactgggggagggt
agtttccctcttcacctttaccggggtgctggccagacaactgcaggagaagaagggggtacaactggggcaggaccccg
ggacgggcagggcactgggacaggttcccggcgggagctgcagggggctggcggagacgatagcggactacctaggggag
gagaagagggactggctgctggagaacgggggctgggaagggttttgtaagttctccaggatcgcccgagaggtgaacca
agagtcttcgatgaagacggcgctgttcgcggccgccggggtgggcatcgcaggcctgacgttccttttggtgcgctag
>gnl|bcl2dbcds|D2IT42_BCL2L10-02 BCL2-like 10 gene OS=[Eukaryota] Gadus morhua GN=BCL2L10 (length=588 residues).
atgtcgtgtaggctgtggaaagagaccctggccctgtcagaggactacctgttgtcctgcactgcaagcacaggcacagc
cccgccgcctcccagcgagtcagccgcggccatgaggggactggcccaggacatggagcggcagcactacgctcgcttcc
aggctctggcccagagcttcctggcccagtgcgaggccgacgcatgcgccggcctccgcaaggtgatggaggagctggtg
ggagacggacagttgaactgggggagggtagtttccctcttcacctttaccggggtgctggccagacaactgcaggagaa
gaagggggtacaactggggcaggaccccgggacgggcagggcactgggacaggttcccggcgggagctgcagggggctgg
cggagacgatagcggactacctaggggaggagaagagggactggctgctggagaacgggggctgggaagggttttgtaag
ttctccaggatcgcccgagaggtgaaccaagagtcttcgatgaagacggcgctgttcgcggccgccggggtgggcatcgc
aggcctgacgttccttttggtgcgctag
>gnl|bcl2dbcds|G3QLU6_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Gorilla gorilla gorilla GN=BCL2L10 (length=615 residues).
atggttgaccagtggcgggagcgcaccaccatggccgacccgctgcgggagcgcaccgagcggttgctggccgactacct
ggggtactgcgcccgggaacccggcacccccgagccgacgccgtccacgcccgaggccgccgtgctgcgctccgcggccg
ccaggttacggcagattcaccggtccttcttctccgcctacctcggctaccccgggaaccgcttcgagctggtggcgctg
atggcggattccgtgctctccgacagccccggccccacctggggcagagtggtgacgctcgtgaccttcgcagggacgct
gctggagagagggccgctggtgaccgcccggtggaagaagtggggcttccagccgcggctaaaggagcaggagggcgacg
tcgcccgggactgccagcgcctggtggccttgctgagctcgcggctcatggggcagcaccgcgcctggctgcaggctcag
ggcggctgggatggcttttgtcacttcttcaggaccccctttccgctggctttttggagaaaacagctggtccaggcttt
tctgtcatgcttgttagcaacagccttcatttatctctggacacgattattatga
>gnl|bcl2dbcds|A0A3Q2UUN9_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Haplochromis burtoni GN=BCL2L10 (length=822 residues).
atgatttatggattatttgtcacccttttttgtaccataccaaaccatgaccacacttccgctggttattccgtggcggt
ggtgtcttctttccacagtccacacgacgttcccagcacaaaaatcatgtcgagaggcggagtcacgcattctgcatcag
ctgaagggaagactcaactgtaccgacgctctccttccgccgtctgtatgtgcagagagcagtctgatatcgctgggagg
aaaatgaaattctgtgggctgtggaaagagaccctggttttggccgaggactacctgtccttttgctgcacgagtccaca
tcaagcccctccacctcccagcgaatcagccgctgccatgaggcgtctaggctgggacatcgaaagacagcaccaagctc
gcttcgacaacctcgctcagaccttcctggtgcagtgtggaccggaccactgcctcagcctcagaaaggtgatgaaggag
ctggttggagatggacacttgaactgggggagggttgtttctcttttcgcctttactggagtgctggccagaaagatcct
ggagcagaagccggggctggaccctcgtcaacagcaggaactgggacaggagcccatgagctgcagaaggctggcagaga
ccatagctgattacctgggagaagagaagaaagactggctgttggataatgatggatgggaaggcttctgtaagttctcc
cgcagtgccagagaagtgagccaggactcatccatgaagaaagcgctgtttgctgccgccggtgtcggccttgctgggct
taccttcctcttggtgcgctag
>gnl|bcl2dbcds|A0A3Q2UUN9_BCL2L10-02 BCL2-like 10 gene OS=[Eukaryota] Haplochromis burtoni GN=BCL2L10 (length=816 residues).
atgatttatggattatttgtcacccttttttgtaccataccaaaccatgaccacacttccgctggttattccgtggcggt
ggtgtcttctttccacagtccacacgacgttcccagcacaaaaatcatgtcgagaggcggagtcacgcattctgcatcag
ctgaagggaagactcaactgtaccgacgctctccttccgccgtctgtatgtgcagagagcagtctgatatcgctgggagg
aaaatgaaattctgtgggctgtggaaagagaccctggttttggccgaggactacctgtccttttgctgcacgagtccaca
tcaagcccctccacctcccagcgaatcagccgctgccatgaggcgtctaggctgggacatcgaaagacagcaccaagctc
gcttcgacaacctcgctcagaccttcctggtgcagtgtggaccggaccactgcctcagcctcagaaaggtgatgaaggag
ctggttggagatggacacttgaactgggggagggttgtttctcttttcgcctttactggagtgctggccagaaagatcct
ggagcagaagccggggctggaccctcgtcaacagcaggaactgggacaggagcccatgagctgcagaaggctggcagaga
ccatagctgattacctgggagaagagaagaaagactggctgttggataatgatggatgggaaggcttctgtaagttctcc
cgcagtgccagagaagtgagccaggactcatccatgaagaaagcgctgtttgctgccgccggtgtcggccttgctgggct
taccttcctcttgtga
>gnl|bcl2dbcds|Q9HD36_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Homo sapiens GN=BCL2L10 (length=615 residues).
atggttgaccagttgcgggagcgcaccaccatggccgacccgctgcgggagcgcaccgagctgttgctggccgactacct
ggggtactgcgcccgggaacccggcacccccgagccggcgccatccacgcccgaggccgccgtgctgcgctccgcggccg
ccaggttacggcagattcaccggtcctttttctccgcctacctcggctaccccgggaaccgcttcgagctggtggcgctg
atggcggattccgtgctctccgacagccccggccccacctggggcagagtggtgacgctcgtgaccttcgcagggacgct
gctggagagagggccgctggtgaccgcccggtggaagaagtggggcttccagccgcggctaaaggagcaggagggcgacg
tcgcccgggactgccagcgcctggtggccttgctgagctcgcggctcatggggcagcaccgcgcctggctgcaggctcag
ggcggctgggatggcttttgtcacttcttcaggaccccctttccactggctttttggagaaaacagctggtccaggcttt
tctgtcatgcttgttaacaacagccttcatttatctctggacacgattattatga
>gnl|bcl2dbcds|Q9HD36_BCL2L10-02 BCL2-like 10 gene OS=[Eukaryota] Homo sapiens GN=BCL2L10 (length=726 residues).
atggttgaccagttgcgggagcgcaccaccatggccgacccgctgcgggagcgcaccgagctgttgctggccgactacct
ggggtactgcgcccgggaacccggcacccccgagccggcgccatccacgcccgaggccgccgtgctgcgctccgcggccg
ccaggttacggcagattcaccggtcctttttctccgcctacctcggctaccccgggaaccgcttcgagctggtggcgctg
atggcggattccgtgctctccgacagccccggccccacctggggcagagtggtgacgctcgtgaccttcgcagggacgct
gctggagagagggccgctggtgaccgcccggtggaagaagtggggcttccagccgcggctaaaggagcaggagggcgacg
tcgcccgggactgccagcgcctggtggccttgctgagctcgcggctcatggggcagcaccgcgcctggctgcaggctcag
ggcggctgggtgagcacgcggcggacaccgggacacggggcgggacgggcagccgggaagcgcccacgaggctggcacgg
atggcttttgtcacttcttcaggaccccctttccactggctttttggagaaaacagctggtccaggcttttctgtcatgc
ttgttaacaacagccttcatttatctctggacacgattattatgagttttaaaacttttaacccgcttctacctgcccaa
ctgtga
>gnl|bcl2dbcds|A0A4W5MLY7_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Hucho hucho GN=BCL2L10 (length=591 residues).
atgtcatgcgggctgtggaaagaaaccctggctatagcagaggactacctgtctgtctgcagtattatccctgccagtgg
gtcccggaaagccccgcccggtcctcctcccagcgactcagctgcagccatgcggtgccaggcccgggacatggaggcca
agcaccgggcccgcttccacgccctagcacacagcttcctgtgccaatgcgggccgaacccctgcgccagtctgaggagg
gtgatggaggagctggtgggagacggacagatgaactgggggagggtggtctctctgttcaccttcactggtgtgctggt
tagagaactacagggggaggacacggaccaggcgctggggaatggcatggggctgggggggaaggagagctgcagggcgc
tggctgagaccatagcagactacctaggagaggagaagagtgactggatgctggagaacaaaggctgggagggcttctgt
aagttcttccacacagcaagagaggtgaaccaggactcgtccatgaagactgccctgtttgctgctgctggcgtgggcat
cgcagggttaaccttcctcctggtccgctaa
>gnl|bcl2dbcds|A0A3Q3EZT5_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Labrus bergylta GN=BCL2L10 (length=621 residues).
atgtgcagagcgcagtctgatatcgctgggaggaaaatgtcgtgcgggctgtggaaagagaccctggctctggcagagga
ctacctgtccctgtgctgcacaagcccacggccagcccctccacctcccagcatgtcagccgctgctataaggcgcctgg
cccaggacatggagaagcagcaccaggcccgcttccaatccctggctcagaccttcctgaggcagtgcgggccggacccc
tgctccggtcttaggaaggtgatggaggaactggtgggagatggacacttgaactggggaagggttgtatcccttttcac
ctttactggggtgctggccagacaactgcaggagcaggaggatgtgaagctggggctggaccctgtgcaggggcagaaac
tgggacagggacccgggcactgcaggggactggcagagaccatagctgactacctgggagaggagaaaaaagagtggctt
ctggagaatgacggatgggagggattctgtgagttctcccgcagcgctagagagacgagccaggactcgtccatgaagac
ggcactgtttgctgcggctggtgtgggccttgctggactcactttcctcctggtgcgctag
>gnl|bcl2dbcds|A0A3Q3EZT5_BCL2L10-02 BCL2-like 10 gene OS=[Eukaryota] Labrus bergylta GN=BCL2L10 (length=630 residues).
atgtgcagagcgcagtctgatatcgctgggaggaaaatgtcgtgcgggctgtggaaagagaccctggctctggcagagga
ctacctgtccctgtgctgcacaagcccacggccagcccctccacctcccagcatgtcagccgctgctataaggcgcctgg
cccaggacatggagaagcagcaccaggcccgcttccaatccctggctcagaccttcctgaggcagtgcgggccggacccc
tgctccggtcttaggaaggtgatggaggaactggtgggagatggacacttgaactggggaagggttgtatcccttttcac
ctttactggggtgctggccagacaactgcaggagcaggaggatgtgaagctggggctggaccctgtgcaggggcagaaac
tgggacagggacccgggcactgcaggggactggcagagaccatagctgactacctgggagaggagaaaaaagagtggctt
ctggagaatgacggatgggagggattctgtgagttctcccgcagcgctagagagacgagccaggactcgtccatgaagac
ggcactgtttgctgcggctggtgtgggccttgctggactcactttcctcctgatccgagtgcaggcctga
>gnl|bcl2dbcds|A0A4W6FHH7_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Lates calcarifer GN=BCL2L10 (length=576 residues).
atgtcatgcgggctgtggaaagagaccctggttctggcagaggactacctgtgcctttgctgcacaagcccagggccagc
ccctccacctcccagcgagtcagccgctgccatgagacgcattgcccaggacatggagacacagcaccaggctcgtttcc
actcccttgctcagaccctgctgaggcagtgcgggccggacccctgctctagcctcaggaaggtgatggaggagctggtg
ggagacggacgcttgaactgggggagggttgtttcccttttcacctttactggggtgctggccagacagctgcaggagca
gaggctggggctggaccccaggcaggggcaggaactgggacaggagcccggaaactgcagggaactggcggagaccatag
ctgattaccttggagaggagaagaaagactggctgctggagaatgatggatgggaggggttctgtaagttctctcatgcc
gccagagaggtgaaccacgactcgtcgatgaagacggtgcttgttgccgctgctggcgtgggcctggctggactcacctt
cctcatggtgcgctag
>gnl|bcl2dbcds|A0A667GW69_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Lynx canadensis GN=BCL2L10 (length=573 residues).
atggctgacgcgttgagggagcgccgcctattgactgactacctggagtactgcgcccgggaccccggcagccccgcgcg
gacgccgtccacgcccgaggccgcggtgctgcgctacctggccgcccagatacggcagcgccaccagcgtttcttgtcgg
cttaccgcggctaccgcggaaaccgcgtggaactggtggcgcggttggagcaggatttactctccaacccccaaaccctc
agctggggccatgtggtagcgctcttgaccttcgcggggacgctgctggagagaccgccgccggggacctacttgaacct
gacgccggcccagcaacaggagctggagtgggaggccaacgttggccaggactgccagcacctggtggctttgctctgca
atcggctcaccggacggcatcgcgcctggctggaggctcacgacggctgggatggcttttgtctcttcttctcacccatg
ctgccatcttcttggagaagactgctggtccaggctcttctgtcatgctttacagtaatgaccttaatctacttctggag
aagattattgtga
>gnl|bcl2dbcds|A0A2K5TKG9_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Macaca fascicularis GN=BCL2L10 (length=570 residues).
actgtagagtccttgagaggccggaccatggctgacccgttgcgggagcgcaccgagcggctcctggccgactatctggg
gccgtccacgcccgaggccgccgtgctgcgctccgcggccgccaggttacggcagctccaccggtccttcttctccgcct
accgcggctaccccgggaaccgcgtcgagctggtggcgctgatggcggaggccgtgctctccgacagccccggccccacc
tggggcagggtggtgtcgctggtgaccttcgcggggacgctgctggagagagagccgctggtgacagcctggtggaagaa
gcggggcttccagccgcggctgaaggagcaggagggcgacgtcgcccgggactgccagcgcctggtggccttgctgagct
cgcggctcgcgggcagcaccgcgcctggcttcaggctcagggcggatggcttttgtcacttcttcaggagcccctttccg
ctggctttttggagaaaactgctgatccaggctttcctggcatgcttgttagcaacagccttcggttatctctggacacg
attattatga
>gnl|bcl2dbcds|F7H6U5_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Macaca mulatta GN=BCL2L10 (length=585 residues).
atggctgacccgttgcgggagcgcaccgagcggctcctggccgactatctggggtgctgcgcccgggaacccggcacccc
tgagccaaggccgtccacgcccgaggccgccgtgctgcgctccgcggccgccaggttacggcagctccaccggtccttct
tctccgcctaccgcggctaccccgggaaccgcgtcgagctggtggcgctgatggcggaggccgtgctctccgacagcccc
ggccccacctggggcagggtggtgtcgctggtgaccttcgcggggacgctgctggagagagagccgctggtgacagcctg
gtggaagaagcggggcttccagccgcggctgaaggagcaggagggcgacgtcgcccgggactgccagcgcctggtggcct
tgctgagctcgcggctcgcggggcagcaccgcgcctggcttcaggctcagggcggctgggatggcttttgtcacttcttc
aggagcccctttccgctggctttttggagaaaactgctgatccaggctttcctggcatgcttgttagcaacagccttcgg
ttatctctggacacgattattatga
>gnl|bcl2dbcds|A0A2K6B2D9_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Macaca nemestrina GN=BCL2L10 (length=585 residues).
atggctgacccgttgcgggagcgcaccgagcggctcctggccgactatctggggtgctgcgcccgggaacccggcacccc
tgagccaagaccgtccacgcccgaggccgccgtgctgcgctccgcggccgccaggttacggcagctccaccggtccttct
tctccgcctaccgcggctaccccgggaaccgcgtcgagctggtggcgctgatggcggaggccgtgctctccgacagcccc
ggccccacctggggcagggtggtgtcgctggtgaccttcgcggggacgctgctggagagagagccgctggtgacagcctg
gtggaagaagcggggcttccagccgcggctgaaggagcaggagggcgacgtcgcccgggactgccagcgcctggtggcct
tgctgagctcgcggctcgcggggcagcaccgcgcctggcttcaggctcagggcggctgggatggcttttgtcacttcttc
aggagcccctttccgctggctttttggagaaaactgctgatccaggctttcctggcatgcttgttagcaacagccttcgg
ttatctctggacacgattattatga
>gnl|bcl2dbcds|A0A8C6EVC2_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Marmota marmota marmota GN=BCL2L10 (length=552 residues).
atggcagacctgctgcaggagcgcaccgccgagctgctgaccgactacctggagtactgtgcccgggagccgggcacccc
cgagccgccgccgtccactcccgaggccgccctgctgcgctccgcggccgcccggttacaacagcaatacgagcccttct
tctccctctaccgcgggcacccaggtaaccgtgtcgagctgatggcacagatggcagaggctgttctttccgacaaccag
gccctcaactggggccgtgtggtgatgcttgtgaccttcgcagggacgctgctggagagaaagcctcaggacacccacgg
gccgcacacccgggaccaagctgccctggactgtcagcgtctcgtggacttgctctgtgctcagctcgtggggcggcacc
gcgcctggctggaggctcaaggcggctgggatggcttttgtgacttctttaggacacccttgccactaacgttttggaga
aatcttctggtccagatttttatgtcgtgccttttagcaactatcttcatctatttctgcaaacgattttaa
>gnl|bcl2dbcds|A0A7N8WMH7_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Mastacembelus armatus GN=BCL2L10 (length=585 residues).
atgtcgtgtgggctgtggaaagagaccctggctctggcagaggattacctgtccctgtgctgcacaagcccacagtcagt
ccctccacctcccagcgagtcagctgctgccatgagatgtctggcccagaaaatggagaggcagcaccaggctcgcttcc
actccctcactcagactttcctgaagcagtgcgggccggacccctgctccagcctcaggaaggttatagaggagctggtg
gcagatggacacttgaactgggggagggttgtttcccttttcacctttactggggtgctgtccagacagctgatggagca
gaagggcatgaagccagggctggactctggaaaggggcaggaattgggacaggggcctgagagctgcaggggactggcag
agaccatagctgattacctgggagaggagaagaaagactggctgcaagagaatgacggatgggaagggttctgcaagttc
tcccacagcgccagagaggtcagccacgactcatccatgaagacagcgctgtttgctgctgctggagtgggtcttgctgg
actcaccttccttctggtgcgttag
>gnl|bcl2dbcds|A0A3P9BLI0_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Maylandia zebra GN=BCL2L10 (length=822 residues).
atgatttatggattatttgtcacccttttttgtaccataccaaaccatgaccacacttccgctggttattccgtggcggt
ggtgtcttctttccacagtccacacgacgttcccagcacaaaaatcatgtcgagaggcggagtcacgcattctgcatcag
ctgaagggaagactcaactgtaccgacgctctccttccgccgtctgtatgtgcagagagcagtctgatatcgctgggagg
aaaatgaaattctgtgggctgtggaaagagaccctggttttggccgaggactacctgtccttttgctgcacgagtccaca
tcaagcccctccacctcccagcgaatcagccgctgccatgaggcgtctaggctgggacatcgaaagacagcaccaagctc
gcttcgacaacctcgctcagaccttcctggtgcagtgtggaccggaccactgcctcagcctcagaaaggtgatgaaggag
ctggttggagatggacacttgaactgggggagggttgtttctcttttcgcctttactggagtgctggccagaaagatcct
ggagcagaagccggggctggaccctcgtcaacagcaggaactgggacaggagcccatgagctgcagaaggctggcagaga
ccatagctgattacctgggagaagagaagaaagactggctgttggataatgatggatgggaaggcttctgtaagttctcc
cgcagtgccagagaagtgagccaggactcatccatgaagaaagcgctgtttgctgccgccggtgtcggccttgctgggct
taccttcctcttggtgcgctag
>gnl|bcl2dbcds|A0A8C5XEX1_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Microcebus murinus GN=BCL2L10 (length=579 residues).
atgggcgacctgttcagggagcgcacggagcggctgctggccgactacctggagtactgcgccagggagccgggcacccc
ggggctgccgccgtcctcgctggaggcggccgcgctgcgcctcgcagccaccaagattcggcagaagcacgcgtctttct
tctcggcctacgtgggctacccggggaaccgcgtctccctgatggagcggatggcggaggccgtgctctccgacagcctc
agctggggccgcgtggtgatgctcctgaccttcgcggggacgcttctagagagagggccgcgggtgaccgcctggtggag
gaagtgggacctcaagccgcagctgaaggagggggatcccgaagtcgcccgggactgccagcgcctggtggccctgctga
gcgcttggctcgcggggcagcaccgcgcctggctgcaggcgcaaggtggctgggatggcttttgtgacttattcaggaaa
cccttaccactagctgtttggaggagactgctggcccaggttcttttgtcatgctttttagcaacgaccgtcatctattt
ctggacacgattattatga
>gnl|bcl2dbcds|A0A3Q3VI28_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Mola mola GN=BCL2L10 (length=591 residues).
atgtcgtgcgggctgtggaaagagaccctggctctcgcacaggactacctgtccttgtgctgcacaagccagcggccagc
ccctccacctcccagcgagtcagccgctgccatgagggacctggctcaggacatggagaagcaacaccaggctcgcttcc
actccctggctcagaccttcttgaggcagtgcgggacggacccatgctccagcctcaggaacgtgatggaggagctggtg
ggagacggacacttgaactgggggagggttgtttccattttcacctttactggggtgctggccagacaactgctcgaaca
gaagagcacaaagccggggctggaacccaggcaggaccaggaccaggaactgggacaagtgcctggtaattgcagtgaac
tggccgagaccatagcagactacctgggagaggagaagaaagcctggctcctggagaacgacggatgggaggggttctgt
aagttctctcactctgccagagaggcaaggctggactcatcgatgaagacggccttgtttgctgctgctggtgtgggtct
cgccggtctcaccttcctgctggtgcgctag
>gnl|bcl2dbcds|F6VJQ0_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Monodelphis domestica GN=BCL2L10 (length=570 residues).
atggattacaagtgtgctcttagggaagagacggcgcggctggtaactgactacctggaatattgttgccggagggaagg
cgtccaggagctgccggcccctacccctgctgcagctacactgcgtttggtgtcgagcgagctccgccagatttaccagg
acttcttcgagtgcgccctgaatcagctactcgaccgggaacctgagcaagtaatcgtcaacgtagcggagctcatggac
cgaggcgagttcaactggggccgggtggcggtgctagtggtttttgccggggcgctgctggagatggaggaactactgaa
agaggagcaggtactgcagcttcggagggaaacgagccggcgtctgaccgaaaaactctgcaactatctggtggagagga
agggcgcgtggctgcatgagaacggaggctggactggctttcaccaccacttcgaaaaaaggcaatctcctccaccaagt
gactcaagtaataatacactgtgctgcataatggcagcagcagcaggatttggactagtgggattagctcttttattagt
cgtacgataa
>gnl|bcl2dbcds|A0A8C6FJ57_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Moschus moschiferus GN=BCL2L10 (length=558 residues).
atggtggacccgtttagggagcgcaccgcccggctgctgctggactacctggagttctgcgcccgggagcccggcgcgcc
agcccctgcgccgtccacgcctgaggctgccgtgctgcgccacgtggccgcccgtgtccaggaagcaaatcgaaacgtct
tgcccctctaccgccgctaccgcaggcaccgcgtcgagctggtggccaggatggcgcagaggctgctcgacgaagaccct
ggccccagctggggccgcgtggcctcactcgtgaccttcgcggggtcgctgctagagaggcctccgcagacgacccgacg
gctggagaagagagacgacggcggcgttagcagggactgtcggctcctggtggcccttctgtgtgctcagttctgcgaaa
ggcaccgcgcctggctgctggcgaacggcggctgggatggattttgtctctccttcagccactcattgcagccatcttgg
gaaagacagctggtctggtttttcttctcatactggacagcaataatcataatctacttctggataaaattatcatga
>gnl|bcl2dbcds|A0A8C6IEV0_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Mus spicilegus GN=BCL2L10 (length=576 residues).
atggccgactcgcaggacccactgcatgaacgcactagacggctgctgtctgactacatattcttctgcgcacgggagcc
ggacaccccagaaccaccgcccacgtctgtcgaggcggctttgcttcgctctgtgactaggcagatccagcaggagcacc
aagaatttttttcctccttctgcgaaagccggggcaaccgcctggaactggtgaaacacatggcggataagttgctctcc
aaagaccaagacttcaactggagccaactggtgatgctcctggccttcgcggggacgcttatgaatcaaggcccttacat
ggctgtcaagcagagaggggatctgaggaatcgtctcatagtgacccgagactgctgtctcatagtgaactttctgtata
atctgctcatggggcgtcggcaccgctccaggctggaggctctcggcggctgggatggcttttgccgcttcttcaagaac
cctttaccgctcggcttctggagaagattgctgattcaggcttttctgtcaggcttctttgcaacagccatcttttttat
ctggaaacgtttataa
>gnl|bcl2dbcds|M3Y8D1_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Mustela putorius furo GN=BCL2L10 (length=681 residues).
atgggtgtggcggcccctccctgggcggaggcgcagcgggacctagaaaaccgggtcgggtcgggcagcgcggggagagg
tcgggccatggcggacgctttgagggagcgcacggcgcagctgctgaccgactacctggagtactgcgcccgcggccccg
gcacccccgcgcggtcgccgtctacgcgcgaggccgcggtgctgcgctcggtggccgccgtcgtgcggcagcgtcacgag
cgcttcttgtcggattaccgcggctacggcggcaaccgcgtcgagctggtggctcagttggagcgggagatactcgccca
cccccaagccctaagctggggccgtgtggtggcgctcgtgaccttcgcgggaacgctgctggagcgcccgccgtcggggg
cctgctcgaacttggggccggacccggaactggaactggagctgggggagtgggaggccagcgttcgccaagactgccgg
cgcctggtggacttcctctgcggtcggctcacagggcagcaccgcgcctggctggaggcgcacggcggctgggatggctt
ttgtctcttcttcacacccgcgctgctgtcttggaaaagactgctggtccaggctcttctgtcatgctttacggcagtga
tcttaatctacttctggaaaagattaccatttattgggtga
>gnl|bcl2dbcds|G1QEX2_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Myotis lucifugus GN=BCL2L10 (length=537 residues).
gacgagttgaagttgcgcacccgacggctgctgaccgagttcctggaacaccgcacccgaaggcgcggcactgccccgca
gcagccgtccacgcccgaggccaccgtgatgcgctccctggctgctcattcgtggctgggtaccccgcactcctggtccc
ggaggcagagaaaccgactcgagcagatggtcgaccagatagagtcgctagttccagacggcacagaccccaactggttg
agcgtggtggcgctcgtgtccttcgcgggggccctgctggagagaccgccgccaggccactcgcaggcacgcagggaatg
ggatgccaccgttgaccaggactgccagcgcctggtcaccttcctgtgcagttggctcacggagacgcaccgcacctgga
tggaggcgcaaggtggctgggatggcttttgtcacaacttcatgcctgcaccgccgcctggggacagactgctggctccg
cttctgagggcatgccttgtactcataatcttaatctgcttgtggataaaaatcatg
>gnl|bcl2dbcds|A0A8C6WBP6_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Nannospalax galili GN=BCL2L10 (length=552 residues).
atggcagatcccctgcgggagcgcacccggcagctgctgatagactacctgctgttctgcgcacgggaaccaggcacccg
ggagctgccaccgagctccagcgaggccgccgtgctgcgctcggtagcggcacagaccctgcagctccaccagcccttct
tctcctccttccgcggctaccagggcaacagtctggagctgctgtcacagatggcggatgtcgtgttgtccgaccagcaa
agcctcaactggggcagagtggtagtgcttgtggccttcgctggcatgctcctggatcaaagcccttgtaagaataccaa
ggggaggaataggctccatgtgctccgggactgcctttacatggtggacctcctatgtactcgcctcactggacggcacc
gtgcttggctggaagctcaggatgactgggatggcttttgccgcttcttcagaagacccttcccactgagtttttggagg
agactgctgctccagatgtttttatcatgcttctttgcaataggcatactatatttgtggaaacgattataa
>gnl|bcl2dbcds|A0A8C6UWE4_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Neogobius melanostomus GN=BCL2L10 (length=564 residues).
atgtcttgtgggctgtggaaagagaccctggctctggcagaggactacctgtgcctgtgctgcagcccccaggcagcccg
tcctcctcccagcgggtcagctgctgccatgaggcgtctgggccaagacatggaggcccagcacaaggcacgcttccaca
ctctgagccagacctttctgaaacagtgcgggccggacccctgctccagtctcaggaaggtcatggaggagctggtggga
gatggactcttgaactggggaagggttgtgtcccttttcacctttgctggggtgctggccagacaaatacaagagcagaa
gtgcagcaggtcagggcaggaccctgggaaagtgcctgcagactgcaggctgctggcagaaaccatagcagattacctgg
gagaggagaagagagactggctgttggacaatggaggctgggtaggcttctgtgagttctcatgccactccaggaaggtg
gaccaggactcatccatgaagaccgctctgtttgctgctgctggggtgggtctcgctggcctcacctttctcttggtgcg
ctag
>gnl|bcl2dbcds|A0A3Q4MN81_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Neolamprologus brichardi GN=BCL2L10 (length=615 residues).
atgtgcagagagcagtctgatatcgctgggaggaaaatgaaattctgtgggctgtggaaagagaccctggttttggccga
ggactacctgtccttttgctgcacgagtccacatcaagcccctccacctcccagcgaatcagccgctgccatgaggcgtc
taggctgggacatcgaaagacagcaccaagctcgcttcgacaacctcgctcagaccttcctggtgcagtgtggaccggac
cactgcctcagcctcagaaaggtgatgaaggagctggttggagatggacacttgaactgggggagggttgtttctctttt
cgcctttactggagtgctggccagaaagatcctggagcagaagccggggctggaccctggtcaacagcaggaactgggac
aggagcccatgagctgcagaaggctggcagagaccatagctgattacctgggagaagagaagaaagactggctgttggat
aatgatggatgggaaggcttctgtaagttctcccgcagtgccagagaagtgagccaggactcatccatgaagaaagcgct
gtttgctgccgccggtgtcggccttgctgggcttaccttcctcttggtgcgctag
>gnl|bcl2dbcds|A0A8C7AU04_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Neovison vison GN=BCL2L10 (length=582 residues).
atggcggacgcgttgagggagcgcacggcgcagctgctgaccgactacctggagtattgcgcccgcggccccggcacccc
cgcgcggtcgccgtctacgcgcgaggccgcggtgctgcgctcggtggccgccgacgtgcggcagcgtcacgagcgcttct
tgtcggattaccgcggctaccgcggcaaccgcgtggagctggtggctcaggtggagcgggagatactcgcccacccccaa
gccctaagctggggccgtgtggtggcgctcttgaccttcgcgggaacgctgctggagcgcccgccgccgggggcctgctc
gaacttggggccggacgcggaactggagctgggggagtgggaggccaccgttcgccaggactgccggcgcctggtggact
tcctctgcggtcggctcgcagggcagcaccgcgcctggctggaggcgcacggcggctgggatggcttttgtctcttcttc
acacccgtgctgctgtcttcttggaaaagactgctggtccaggctcttctgtcatgctttacggcagtgatcttaatcta
cttctggaaaagattaccgtga
>gnl|bcl2dbcds|G1R3W6_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Nomascus leucogenys GN=BCL2L10 (length=696 residues).
atggttgaccagttgcgggagcgcaccgagcggctgctggccgactacctggggtgctgcgcccgggaacccggcacccc
cgagccgacgccgtccacgcccgaggccgccatgctgcgctccgcggccgccaggttacggcagctccacccgtccttct
tctccgcctacctcggctaccctgggaaccgcgtcgagctggtggtgctgatggcggattccgtgctctccgacagcccc
ggccccacctggggcagagtggtgacgctcgtggccttcgcagggacgctgctggagagagggccgctggtgaccgcccg
gtggaagaagtggggcttccagccgcggctaaaggagcaggagggcgacgtcgcccgggactgccagcgcctggtggcct
tgctgagctcgcgcctcgtggggcagcaccgcgcctggctgcaggctcagggcggctgggtgagcacgcggcggacaccg
ggacacggggcgggacgggcagccgggaagcgcccacgaggccggcacggatggcttttgtcacttcttcaggaccccct
ttccgctggctttttggagaaaacagctggtccaggcttttctgtcatgcttgttaacaacagccttcatttatttctgg
acacgattattatgagttttaaaacttttaacccgcttctacctgcacagctgtga
>gnl|bcl2dbcds|A0A1A8VCB0_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Nothobranchius furzeri GN=BCL2L10 (length=768 residues).
atgggcggagggctaaatgcgcagaagggaagcggtgattgccccgaggttctccttccgccgtctggatgtggcgagag
ctgtcacctaccgctgggaggagaacatgggaccagtgatcgggccagcatgtctacgtccggaccatgggtccctacca
ggggcgtggctagcctctcttacagcaaaatgtcctgtgggctgtggaatgatactctggctgtggccgaggattacctg
tccacgtgctgctgcggcccaaatccagcccctccacctcccagcgagacagccgctgccatgaggcgtctggcccagga
tatggagacccagcaccagacccgtttccactctctggctcagaacttcctgaagcgctgcgggccagacatctgctcta
gcctcaggaaggtgatggacgagatggctggagacggacactttaactgggggcgggttgtgtccctctttgcttttact
ggggtgctgatcagacagctgcaggagcagaggacctccagaccggggctggaccctgggcaagagctggaaccgaagct
catcagctgtcggttgctggcggagaccatagctgattacctggtgaagcacaagaaaggctggctgttggagaatgaag
gatgggaaggcttcagccagtactcccacaacaccagaccagtaagtctggactcctccatgaagacagcgctggttgct
gttgctggagttggcctggctgggctaacctttctcctggtgcgctag
>gnl|bcl2dbcds|A0A1A8VCB0_BCL2L10-02 BCL2-like 10 gene OS=[Eukaryota] Nothobranchius furzeri GN=BCL2L10 (length=615 residues).
atgtggcgagagctgtcacctaccgctgggaggaaaatgtcctgtgggctgtggaatgatactctggctgtggccgagga
ttacctgtccacgtgctgctgcggcccaaatccagcccctccacctcccagcgagacagccgctgccatgaggcgtctgg
cccaggatatggagacccagcaccagacccgtttccactctctggctcagaacttcctgaagcgctgcgggccagacatc
tgctctagcctcaggaaggtgatggacgagatggctggagacggacactttaactgggggcgggttgtgtccctctttgc
ttttactggggtgctgatcagacagctgcaggagcagaggacctccagaccggggctggaccctgggcaagagctggaac
cgaagctcatcagctgtcggttgctggcggagaccatagctgattacctggtgaagcacaagaaaggctggctgttggag
aatgaaggatgggaaggcttcagccagtactcccacaacaccagaccagtaagtctggactcctccatgaagacagcgct
ggttgctgttgctggagttggcctggctgggctaacctttctcctggtgcgctag
>gnl|bcl2dbcds|A0A668SSC1_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Oreochromis aureus GN=BCL2L10 (length=696 residues).
atgtcgagaggcggagtcacacattctctatcagctgaagggaagactcaactgtaccgacgctctccttccgccgtctg
tatgtgcagagagcagtctgatatcgctgggaggaaaatgaaattctgtgggctgtggaaagagaccctgcttttggccg
aggactacctgtccttttgctgcacgagtccacatcaagcccctccacctcccagcgaatcagccgctgccatgaggcgt
ctgggctgggacatcgaaagacagcaccaagctcgcttcgacaacctcgctcagaccttcctggtgcagtgtgggccgga
ccactgcctcagcctcagaaaggtgatgaaggagctggttggagatggacacttgaactgggggagggttgtttctcttt
ttgcctttactggagtgctggccagaaagatcctggagcagaagccggggctggaccctgggcaacagcaggaactggga
caggagcccatgagctgcagaaggctggcagagaccatagctgattacctgggagaagagaagaaagactggctgttgga
taatgatggatgggaaggcttctgtaagttctcccgcagtgccagagaagtgagccaggactcatccatgaagaaagcgc
tgtttgctgccgccggtgtcggccttgctgggcttaccttcctcttggtgcgctag
>gnl|bcl2dbcds|A0A669EYA1_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Oreochromis niloticus GN=BCL2L10 (length=696 residues).
atgtcgagaggcggagtcacacattctctatcagctgaagggaagactcaactgtaccgacgctctccttccgccgtctg
tatgtgcagagagcagtctgatatcgctgggaggaaaatgaaattctgtgggctgtggaaagagaccctgcttttggccg
aggactacctgtccttttgctgcacgagtccacatcaagcccctccacctcccagcgaatcagccgctgccatgaggcgt
ctgggctgggacatcgaaagacagcaccaagctcgcttcgacaacctcgctcagaccttcctggtgcagtgtgggccgga
ccactgcctcagcctcagaaaggtgatgaaggagctggttggagatggacacttgaactgggggagggttgtttctcttt
ttgcctttactggagtgctggccagaaagatcctggagcagaagccggggctggaccctgggcaacagcaggaactggga
caggagcccatgagctgcagaaggctggcagagaccatagctgattacctgggagaagagaagaaagactggctgttgga
taatgatggatgggaaggcttctgtaagttctcccgcagtgccagagaagtgagccaggactcatccatgaagaaagcgc
tgtttgctgccgccggtgtcggccttgctgggcttaccttcctcttggtgcgctag
>gnl|bcl2dbcds|G1T264_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Oryctolagus cuniculus GN=BCL2L10 (length=564 residues).
atggcagacgctttggaggagcgcactgcgcgcctgctcaccgactacctggagtgctgcgcccgcgagcccggcacccc
tgagccgcagccgtccacgccggaggcggctgtgctgcgctgtgcggccacgcagcttcagcgggtccactggcccttct
tctccgtctaccgcggctaccccggcaaccgcatcgagctggcggcgcgcgtggcggaggccgtgctctccgacggccac
gacctcagctggggccgcgtggtgacgctcgtgaccttcgccgggacgcttctggacagagggccgccggtgaccaccca
gcgggtgaggaggaatgaaatcgcccgggactgccagcgcttggtggccttgctgtgcgctcgcctcgcagggcagcacc
gcgcctggctgcaggctcaaggcggctgggatggcttttgtgtcttctaccggactcccttaccgctgaccttctggaga
agactgctggtccgcacttttctgtcctgctttgtagctacagccttactcttcgcctggacgcgcgtgtatcgtgagtt
gtaa
>gnl|bcl2dbcds|A0A3P9IIZ2_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Oryzias latipes GN=BCL2L10 (length=579 residues).
atgtcttgtgggctgaggaaagagaccctagctgtggccctggattacctgtccctgagctgcaggagcccactccaggc
ccccccacctcccagcgagtcagctgctgccatgaggcgcctggcccaggacatggaggcgcagtaccagccccgcttct
ccaccttagcacagaacttcaggaagcacagcgggcaggacctgtgctccagcctcaggaaggtgatggaggagctggtg
ggagatgaacgcttgaactgggggagggtcgtttccctttttgcattcgtgggagtgctggcgaggcagctgagggagca
aacagacatgaacccggggctggaccccgggcgggaagtggcggccgggcctgtgagctgccaggcgctggcagaaactg
tagctgatttcctgggaggagacaagaaagagtggatgctagaaaatgatggatgggaaggcttctgtaagttctccaga
acagccagagaggtgagtcaggactcgtccatgaagactgcgctcttcgcggcggccagcgtcggcctggctggactcac
cttcctcctggtgcgctag
>gnl|bcl2dbcds|A0A3P9LM07_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Oryzias latipes GN=BCL2L10 (length=579 residues).
atgtcttgtgggctgaggaaagagaccctagctgtggccctggattacctgtccctgagctgcaggagcccactccaggc
ccccccacctcccagcgagtcagctgctgccatgaggcgcctggcccaggacatggaggcgcagtaccagccccgcttct
ccaccttagcacagaacttcaggaagcacagcgggccggacctgtgctccagcctcaggaaggtgatggaggagctggtg
ggagatgaacgcttgaactgggggagggtcgtttccctttttgcattcgtgggagtgctggcgaggcagctgagggagca
aacagacatgaacccggggctggaccccgggcgggaagtggcgcccgggcctgtgagctgccaggcgctggcagaaactg
tagctgatttcctgggaggagacaagaaagagtggatgctagaaaatgatggatgggaaggcttctgtaagttctccaga
acagccagagaggtgagtcaggactcgtccatgaagactgcgctcttcgcggcggccagcgtgggcctggctggactcac
cttcctcctggtgcgctag
>gnl|bcl2dbcds|H2MBQ3_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Oryzias latipes GN=BCL2L10 (length=579 residues).
atgtcttgtgggctgaggaaagagaccctagctgtggccctggattacctgtccctgagctgcaggagcccactccaggc
ccccccacctcccagcgagtcagctgctgccatgaggcgcctggcccaggacatggaggcgcagtaccagccccgcttct
ccaccttagcacagaacttcaggaagcacagcgggccggacctgtgctccagcctcaggaaggtgatggaggagctggtg
ggagatgaacgcttgaactgggggagggtcgtttccctttttgcattcgtgggagtgctggcgaggcagctgagggagca
aacagacatgaacccggggctggaccccgggcgggaagtggcgcccgggcctgtgagctgccaggcgctggcagaaactg
tagctgatttcctgggaggagacaagaaagaatggatgctagaaaatgatggatgggaaggcttctgtaagttctccaga
acagccagagaggtgagtcaggactcgtccatgaagactgcgctcttcgcggcggccagcgtgggcctggctggactcac
cttcctcctggtgcgctag
>gnl|bcl2dbcds|A0A3B3C5I4_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Oryzias melastigma GN=BCL2L10 (length=606 residues).
atggatggtttttctgctcagaaaatgtcttgtgggctgaggaaagagaccctagctgtggccctggattacctgtccct
gagctgcaggagcccagtcctccaggcccccccacctcccagcgagtcagcttctgccatgcggcgcctggcccaggaca
tggagacgcagtaccagccccgcttctccacgctagctcaggacttcaggaagcactgcgggccggacctgtgctccagc
ctcaggaaggtgatggaggagctggtgggagatgaacacttgaactgggggagggttgtttccctttttgcattcgtggg
agtgctggcgagacagctgagggagcaaacggacacgaacccggggctggacctcgggcgggaagcggcacccggacctg
tgagctgccaggcgctggcagaaactgtagctgatttcctgggaggagacaagaaagagtggatgctagaaaatgatgga
tgggaaggcttctgtaagttctccagaacagccagagaggtgagccaggactcgtccatgaagacggcgctctttgcagc
ggccagcgtgggcctggccggactcaccttcctcctggtgcgctag
>gnl|bcl2dbcds|A0A8C7XY96_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Oryzias sinensis GN=BCL2L10 (length=579 residues).
atgtcttgtgggctgaggaaagagaccctagctgtggccctggattacctgtccctgagctgcaggagcccactccaggc
ccccccacctcccagcgagtcagctgctgccatgaggcgcctggcccaggacatggaggcgcagtaccagccccgcttct
ccaccttagcacagaacttcaggaagcacagcgggccggacctgtgctccagcctcaggaaggtgatggaggagctggtg
ggagatgaacgcttgaactgggggagggtcgtttccctttttgcatttgtgggagtgctagcgcggcagctgagggagca
aacagacatgaacccggggctggaccccgggcgggaagtggcgggcgggcctgtgagctgccaggcgctggcagaaactg
tagctgatttcctgggaggagacaagaaagagtggatgctagaaaatgatggatgggaaggcttctgtaagttctccaga
acagccagagaggtgagtcaggactcgtccatgaagactgcgctcttcgcggcggccagcgtcggcctggctggactcac
cttcctcctggtgcgctag
>gnl|bcl2dbcds|H0WZ06_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Otolemur garnettii GN=BCL2L10 (length=576 residues).
atggcagacccgttgagggagcgcaccgagcggctgctgactgactacctggagtactgcgcgcgggatccgactgcccc
ggagccgacgccgtcctcgcccgaggccgccttgctgcgctccgtgaccgcctatatacagcagcgccactggtcctttt
tctccgcctacataggctaccccgggaatcgcgttcaggtggtggaacggatggtgaaggctatgctctcagacaaccag
agactcaactggggccgagtggtgacgctcgtgaccttcgcagggacgcttctacagaggcctccagtagaagccaggcg
ggagaagcaggacaagtcgcaactgaaggagggagaagacgaagtcgccagggattgccagcgcctagtggccctactga
gctctcggctggtggggcagcaccgcgtttggctggaggctcaaggcggctgggatggcttttgtcagttcttcaggaca
cccttaccgctagctttttggagaagattgctgttcgaagttttactgttgtgctttttagcaacggtcttcatctattt
ctggacacgacttact
>gnl|bcl2dbcds|W5QIG4_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Ovis aries GN=BCL2L10 (length=582 residues).
ggtcggccccccggtagaggcggagccatggtggacccgtttagggagcgcacggcccggctgctgatggactggctgga
gttctgcgcccgggagcccggcactccagctcctgcgccgtccacgcccgaggctgctgtgctgcgccacgtggccgccc
gtgtcctggaagcaaatcgaaacgtcttgcccctataccgccgctaccgcaggcaccgcgtcgagctggtggccaggatg
gcgcagaggctgctcgacgaagaccctggccccagctggggccgcgtggcctcactcgtgaccttcgcggggtctctgct
ggagaggcagccgcagacgacccgacggcagaagagagacgacggcagcgttagcagggactgtcggctcctcgtggccc
ttctctgcgctcagttctgcgaaaggcaccgcgcctggctgatggcgaacggcggctgggatggattttgtctctccttc
agccactcattgcaaccatcttgggaaagacagctggtctggtttttcctctcatactggacagcaataatcataatcta
cttctggataaaattatcgtga
>gnl|bcl2dbcds|A0A2R9BCD9_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Pan paniscus GN=BCL2L10 (length=615 residues).
atggttgaccagtggcgtgagcgcactaccatggccgacccgctgcgggagcgcaccgagcggttgctggccgactacct
ggggtactgcgcccgggaacccggcacccccgagccgacgccgtccacgcccgaggccgccgtgctgcgctccgcggccg
ccaggttacggcagatccaccggtccttcttctccgcctacctcggctaccccgggaaccgcttcgagctggtggcgctg
atggcggattccgtgctctccgacagccccggccccacctggggcagagtggtgacgctcgtgaccttcgcagggacgct
gctggagagagggccgctggtgaccacccggtggaagaagtggggcttccagccgcggctaaaggagcaggagggcgacg
tcgcccgggactgccagcgcctggtggccttgctgagctcgcggctcgtggggcagcaccgcgcctggctgcaggctcag
ggcggctgggatggcttttgtcacttcttcaggaccccctttccgctggctttttggagaaaacagctggtccaggcttt
tctgtcatgcttgttaacaacagccttcatttatctctggacacgattattatga
>gnl|bcl2dbcds|H2Q9G4_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Pan troglodytes GN=BCL2L10 (length=615 residues).
atggttgaccagtggcgtgagcgcaccaccatggccgacccgctgcgggagcgcaccgagcggttgctggccgactacct
ggggtactgcgcccgggaacccggcacccccgagccgacgccgtccacgcccgaggccgccgtgctgcgctccgcggccg
ccaggttacggcagatccaccggtccttcttctccgcctacctcggctaccccgggaaccgcttcgagctggtggcgctg
atggcggattccgtgctctccgacagccccggccccacctggggcagagtggtgacgctcgtgaccttcgcagggacgct
gctggagagagggccgctggtgaccacccggtggaagaagtggggcttccagccgcggctaaatgagcaggagggcgacg
tcgcccgggactgccagcgcctggtggccttgctgagctcgcggctcgtggggcagcaccgcgcctggctgcaggctcag
ggcggctgggatggcttttgtcacttcttcaggaccccctttccgctggctttttggagaaaacagctggtccaggcttt
tctgtcatgcttgttaacaacagccttcatttatctctggacacgattattatga
>gnl|bcl2dbcds|A0A8C8WKU6_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Panthera leo GN=BCL2L10 (length=573 residues).
atggctgatgcgttgagggagcgccgcctactgactgactacctggagtactgcgcccgggagcccggcagccccgcgcg
gacgccgtccacgcccgaggccgcggtgctgcgctacctggccgcccagatacggcagcgccaccagcgtttcttgtcgg
cttaccgcggctaccgcggaaaccgcgtggaactggtggcgcggttggagcgggatttactctccaacccccaaaccctc
agttggggccatgtggtagcgctcttgaccttcgcggggacgctgctggagagaccgccgccggggacctacttgaacct
gacgccgggccagcaacaggagctggagtgggagaccaacgttggccaggactgccagcacctggtggctttgctctgca
atcggctcaccggacggcatcgggcctggctggaggctcacgacggctgggatggcttttgtctcttcttctcacccatg
ctgccatcttcttggagaagactgctggtccaggcttttctgtcatgctttacagtaatgatcttaatctacttctggag
aagattatcgtga
>gnl|bcl2dbcds|A0A096NM44_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Papio anubis GN=BCL2L10 (length=585 residues).
atggctgacccgttgcgggagcgcaccgagcggctcctggccgactatctggggtgctgcgcccgggaacccggcacccc
tgagccgaggccgtccacgcccgaggccgccgtgctgcgctcagcagccgccaggttacggcagctccaccggtccttct
tctccgcctaccgcggctaccccgggaaccgcgtcgagctggtggcgctgatggcggaggccgtgctctccgacagcccc
ggccccacctggggcagggtggtgtcgctggtgaccttcgcggggacgctgctggagagagagccgctggtgacagcctg
gtggaagaagcggagcttccagccgcggctgaaggagcaggagggcgacgtcgcccgggactgccagcgcctggtggcct
tgctgagctcgcggctcgcggggcagcaccgcgcctggcttcaggctcagggcggctgggatggcttttgtcacttcttc
aggagcccctttccgctggctttttggagaaaactgctgatccaggctttcctggcatgcttgttagcaacagccttcgg
ttatctctggacacgattattatga
>gnl|bcl2dbcds|A0A8I5NQD2_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Papio anubis GN=BCL2L10 (length=612 residues).
actgtagagtccttgagaggccggaccatggctgacccgttgcgggagcgcaccgagcggctcctggccgactatctggg
gtgctgcgcccgggaacccggcacccctgagccgaggccgtccacgcccgaggccgccgtgctgcgctcagcagccgcca
ggttacggcagctccaccggtccttcttctccgcctaccgcggctaccccgggaaccgcgtcgagctggtggcgctgatg
gcggaggccgtgctctccgacagccccggccccacctggggcagggtggtgtcgctggtgaccttcgcggggacgctgct
ggagagagagccgctggtgacagcctggtggaagaagcggagcttccagccgcggctgaaggagcaggagggcgacgtcg
cccgggactgccagcgcctggtggccttgctgagctcgcggctcgcggggcagcaccgcgcctggcttcaggctcagggc
ggctgggatggcttttgtcacttcttcaggagcccctttccgctggctttttggagaaaactgctgatccaggctttcct
ggcatgcttgttagcaacagccttcggttatctctggacacgattattatga
>gnl|bcl2dbcds|A0A3B4AAV4_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Periophthalmus magnuspinnatus GN=BCL2L10 (length=585 residues).
atgtcgtgtgggctgtggaaagagaccttggctctggcagaggactacctgagcctgtgctgcagcggcccacaggcagc
tcctccacctcccagcgggtcagcctctgccatgaggcgcctgggccaggacatggaggcccagcacaaggcacgcttcc
actctctgagccagaccttcctcaagcagtgtgggccggacccctgctccagtctccggaaggtcatggaggagctggtg
ggagatggacacttgaactggggaagggttgtgtcccttttcacctttgctggggtgctggccagacacataaaagagca
gaagagtagcagaccagggctggaccctggacaagttcaaggtttgggacaggtgccctcagactgcaggcggctggcac
aaactatagctgattacttgggggaagagaagagggactggctgttggaaaacggtggctgggtaggcttctgtgagttc
tcctgtcatgccaggaaggtggaccaggactcgtcgatgaagaccgctctgtttgctgctgctggggtgggtttagctgg
gcttacctttctcttggtgcgctag
>gnl|bcl2dbcds|A0A8C8UAX6_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Peromyscus maniculatus bairdii GN=BCL2L10 (length=582 residues).
gtgagcgacagccagaggatgggtgatccgctgctggaacgcaccagaaggctgctgactgactacttgacgttctgtgc
gcgggagccgggcacccccgagccgccgcccgggtcgaccgaggcggccttgctgcgctctgtggcaggtgaagtccaag
agaactaccaggaattcttctcctccttcctgggctaccagggcaaccgcctggagctggtgacacggatggtggatgtg
gtgctctccgataccatcaactggggccgcctggtgttggtcttgaccttcgcagggacgcttctgaagcaaggcccttg
caaggctaccaagcagaagaggcgtggtcgggggaatcaatcccaagtgacccgagactgccagctcatagtggactttc
tatgcagtcggatcctgggacagcatcgttcctggctggaggctcaggatggctgggatggcttttgcgacttcttcaag
agcccctttccactctgtttttggagactggtgatcaagactcttctgtactgcctcattgcaacagccaccctgtatgt
ctggaaacaatttagattttaa
>gnl|bcl2dbcds|A0A8C9LKG6_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Piliocolobus tephrosceles GN=BCL2L10 (length=585 residues).
atggctgacccgttgcgcgagcgcaccgagcggctgctggccgactatctggggtgctgcgcccgggaacccggcacccc
cgagccgaggccgtccacgcccgaggccgccgtgctgcgctccgcggcggccaggttacggcagctccatcggtccttct
tctctgcctacctcggctaccccgggaaccgcgtcgagctggtggcgctgatggcggaggccgtgctctccgacagcccc
ggccccacctggggcagggtggtgtcgctggtgaccttcgcggggacgctgctggagagagagccgctggtgacagcctg
gtggaggaagcggagcttccagccgcggctgaaggagcaggagggcgacgtcgcccgggactgccagcgcctggtggcct
tgctgagctcgcggctcgcggggcagcaccgcgcctggcttcaggctcagggcggctgggatggcttctgtcacttcttc
aggaccccctttccgctggctttttggagaaaactgctgatccaggctttcctggcatgcttgttaacaacagccttcgg
ttatctctggacacgattattatga
>gnl|bcl2dbcds|A0A096ME02_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Poecilia formosa GN=BCL2L10 (length=651 residues).
atgcaccgaggttctccttccgccgtctggatgtgcagagagccgtcacatatcgctgggaggaaaatgtcctgtgggct
gtggaaagagaccgtggctgttgcagaggattacatccacctgcgctgctcaagcccacacccagcccctccacctccca
gcgagccggctgccgccatgaggcgcctggcccaggacgtggaggcccagcaccaggctcgctttcactccctggcccag
ggcttcctgaagcactgcgggacagacctctgctccaacctcagaaaggtgatggatgagatggtgggagatggacattt
taactgggggagggtggtgtccctcttcgccttcgctggcgtgctggccagacagctgcgggaacagacgggcaagaacc
cggggccggactccgggaagcagcaggaactgcaacaagagcccgtaagctgccgggcgctggcggagaccattgctgat
tacctggagaagcacaaaaaagactggctgcaggaaaataatggatgggacgggttttgtagctacgcccacaacgccag
agaagtaagtcaggactcctccatgaagacggcgctggttgctgtcgccggagtcggcatcgcagggctcaccttccttc
tggtgcgctag
>gnl|bcl2dbcds|A0A3B3TYN4_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Poecilia latipinna GN=BCL2L10 (length=651 residues).
atgcaccgaggttctccttccgccgtctggatgtgcagagagccgtcacatatcgctgggaggaaaatgtcctgtgggct
gtggaaagagaccgtggctgttgcagaggattacatccgcctgtgctgctcaagcccacacccagcccctccacctccca
gcgagccggctgccgccatgaggcgcctggcccaggacgtggaggcccagcaccaggctcgctttcactccctggcccag
ggcttcctgaagcactgcgggacagacctctgctccaacctcagaaaggtgatggatgagatggtgggagatggacattt
taactgggggagggtggtgtccctcttcgccttcgctggcgtgctggccagacagctgcgggaacagacgggcaagaacc
cggggccggactctgggaagcagcaggaactgcaacaagagcccgtaagctgccgggcgctggcggagaccattgctgat
tacctggagaagcacaaaaaagactggctgcaggaaaataatggatgggacgggttttgtagctacgcccacaacgccag
agaagtaagtcaggactcctccatgaagacggcgctggttgctgtcgccggagtcggcatcgcagggctcaccttccttc
tggtgcgctag
>gnl|bcl2dbcds|A0A3B3YT99_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Poecilia mexicana GN=BCL2L10 (length=651 residues).
atgcaccgaggttctccttccgccgtctggatgtgcagagagccgtcacatatcgctgggaggaaaatgtcctgtgggct
gtggaaagagaccgtggctgttgcagaggattacatccacctgcgctgctcaagcccacacccagcccctccacctccca
gcgagccggccgccgccatgaggcgcctggcccaggacgtggaggcccagcaccaggctcgctttcactccctggcccag
ggcttcctgaagcactgcgggacagacctctgctccaacctcagaaaggtgatggatgagatggtgggagatggacattt
taactgggggagggtggtgtccctcttcgccttcgctggcgtgctggccagacagctgcgggaacagacgggcaagaacc
cggggccggactccgggaagcagcaggaactgcaacaagagcccgtaagctgccgggcgctggcggagaccattgctgat
tacctggagaagcacaaaaaagactggctgcaggaaaataatggatgggacgggttttgtagctacgcccacaacgccag
agaagtaagtcaggactcctccatgaagacggcgctggttgctgtcgccggagtcggcatcgcagggctcaccttccttc
tggtgcgctag
>gnl|bcl2dbcds|A0A3P9NE65_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Poecilia reticulata GN=BCL2L10 (length=651 residues).
atgcgccgaggttctccttccgccgtctggatgtgcagagagccgtcacatatcgctgggaggaaaatgtcctgtgggct
gtggaaagagaccgtggctgtcgcagaggattacatccacctgcgctgctcaaacccacacccagcccctccacctccca
gcgagccggccgccgccatgaggcgcctggcccaggacgtggaggcccagcaccaggctcgctttcactccctggcccag
ggcttcctgaagcactgcgggacggatctctgctccaacctcagaaaggtgatggatgagatggtgggagatggacactt
taactgggggagggtggtgtccctcttcgccttcgccggcgtgctggccagacagctgcgggaacagacgggcaagaacc
cggggccggactccgggaagcagcaggaactgcaacaagagaccgtaagctgccgggcgctggcggagaccattgctgat
tacctggagaagcacaaaaaagactggctgcaggaaaataatggatgggacgggttttgtagctatgccctcaatgccag
agaagtaagtcaggactcctccatgaagacggcgctggttgctgtcgccggggtcggcatcgctgggctcaccttccttc
tggtgcgctag
>gnl|bcl2dbcds|H2NN92_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Pongo abelii GN=BCL2L10 (length=615 residues).
atggttgaccagttgcgggagcgcactatcacggccgacctgctgagggagcgcaccgagcggctgctggccgactacct
ggggtgctgcgcccgggaacccggcaccccagagccgacgccgcccacgcccgaggccgccgtgctgcgctccgcggccg
ccaggttacggcagctccaccggtccttcttctccgcctacctcggctaccccgggaaccgcgtcgaactggtggcgctg
atggcggattccgtgctctccgacagccccagccccacctggggcagagtggtgacgctcgtgaccttcgcagggacgct
gctggagagagggccgctggtgaccgcccggtggaagaattggggcttccagccgcggctaaaggagcaggagggcgacg
tcgcccgggactgccagcgcctggtggccttgctgagctcgcggctcgtggggcagcaccgcgcctggctgcaggctcag
ggcggctgggatggcttttgtcacttcttcaggaccccccttccgctggctttttggagaaaacagctggtccaggcttt
tctgtcatgcttgttaacaacagccttcatttatctctggacacgattattatga
>gnl|bcl2dbcds|A0A8C9A798_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Prolemur simus GN=BCL2L10 (length=579 residues).
atgggcgacccgcttagggagcgcacggagcggctgctggccgactacttggggtattgcgcaagggagccgggcgcccc
ggggccgccaccgtcctcgctcgaggcagccatgctgcgctccgccgccaccaagatacggcgaaagcacgcgtccttct
tctccgcctacgtcggctacccggggaaccgcgtctacctgatggagcggatggcggaggccgtgctctccaacagcctc
agctggggccgggtggtgatgctcgtgaccttcgcagggacgcttctagagagagggccgccggtgaccgcctggtggaa
gaagtgggacctcaggccgcagctgaaggagagcgagaccgaagtcgccagggactgccagcgcctggtggccctgctgt
gcgctctgctcgcagggcagcaccgcgcctggctgcaggcgcagggcggctgggatggcttttgtgacttattcaggaga
cccttaccgctagctgtttggaggagactgctggcccaggttcttttgtcatgctttttagcaacggctgtcatctattt
ctgtacacgattattatga
>gnl|bcl2dbcds|A0A2K6F2Q2_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Propithecus coquereli GN=BCL2L10 (length=579 residues).
atgggtgaccggttcagggagcgcaccgagcggctgctggccgactacctggagtactgcacaagggagccgggcgcccc
ggggctgccgccgtcctcgctcgaggccgccgcgatgcgcttcgcagccaccaagatacggcggaagcacgcgtccttct
tctccgcctacgtcggctaccccgggaaccgcgtctacctgctggagcggatggcggaggccgtgctctgcgacagcctc
agctggggccgggtagtgatgctcgtgaccttcgcagggacgcttctagagagagggccgccggtgaccgcctggtggaa
gaagtggggcctccagccgcagccgaaggagggggatcccgaagtcgcccgggaccgccagcgcctggtggccctgctgt
gcgcccggctggcggggcagcaccgcgcctggctgcaggctcaaggcggctgggatggcttttgtgacttattcaggaaa
cccttgccgctagctgtttggaggagactgctggtccaggttcttttgtcatgctttttagcaacgaccgtcatctattt
ctggacacgattattatga
>gnl|bcl2dbcds|A0A3B4ETX9_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Pundamilia nyererei GN=BCL2L10 (length=615 residues).
atgtgcagagagcagtctgatatcgctgggaggaaaatgaaattctgtgggctgtggaaagagaccctggttttggccga
ggactacctgtccttttgctgcacgagtccacatcaagcccctccacctcccagcgaatcagccgctgccatgaggcgtc
taggctgggacatcgaaagacagcaccaagctcgcttcgacaacctcgctcagaccttcctggtgcagtgtggaccagac
cactgcctcagcctcagaaaggtgatgaaggagctggttggggatggacacttgaactgggggagggttgtttctctttt
cgcctttactggagtgctggccagaaagatcctggagcagaagccggggctggaccctggtcaacagcaggaactgggac
aggagcccatgagctgcagaaggctggcagagaccatagctgattacctgggagaagagaagaaagactggctgttggat
aatgatggatgggaaggcttctgtaagttctcccgcagtgccagagaagtgagccaggactcatccatgaagaaagcgct
gtttgctgccgccggtgtcggccttgctgggcttaccttcctcttggtgcgctag
>gnl|bcl2dbcds|A0A671DJP1_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Rhinolophus ferrumequinum GN=BCL2L10 (length=681 residues).
gtctgtgtccaattaagagaaagaaattgggtcaaggcggacgggttgcggtcgcgccctgcgcggctgctaaccgactc
cctggcgtactgcgcccggggacccagcactgccacgctgccaccgtccgcgcccaaggccgccgtgctgcgctccgtgg
ccgcccaggtacagaggcgttaccagctcgtctggtcctgctaccgcggatatcagggaaatcgcgtcgtgctagtggaa
caggtggcgcaggagattctccacgacggccgcgttcccaggtggggccatgtggtggcgcgtattagtttcgcggggac
gctgctggagaaaccgccgccaggccgcaggctgagactgaaggaatgcgaggccgacgtttcccgggactgccaaagcc
tcgtggccttgctgtgcgactggctcagcacgcgcttggctagaggtaccaggcggttgggtgagcggggccagggaacc
cgggagggcctggcggggcgggcatcccgggacgcgcccctgcgacgggcacccggcgacctagtggccccagtcccgtg
ggcacattcgtttcagcagcgctgggaggttgagtgtgaattccagctttctcctcttttggcggagtcaggctgggaga
aaccggcctctctagacggctctcttattaagcggttctga
>gnl|bcl2dbcds|A0A2K6M5H5_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Rhinopithecus bieti GN=BCL2L10 (length=615 residues).
atggctgacccgttgcgggagcgcaccaccgtggctgacccgttgcgcgagcgcaccgagcggttgctggccgactatct
ggggtgctgcgcccgggaacccggcacccccgagccgaggccgtccacgcccgaggccgccgtgctgcgctccgcggcgg
ccaggttacggcagctccaccggtccttcttctctgcctacctcggctaccccgggaaccgcgtcgagctggtggcgctg
atggcggaggccgtgctctccgacagccccggccccacctggggcagggtggtgtcgctggtgaccttcgcggggacgct
gctggagagagagccgctggtgacagcctggtggaagaagcggagcttccagccgcggctgaaggagcaggagggcgacg
tcgcccgggactgccagcgcctggtggccttgctgagctcgcggctcacggggcagcaccgcgcctggcttcaggctcag
ggcggctgggatggcttttgtcacttcttcaggaccccctttccgctggctttttggagaaaactgctgatccaggcttt
cctggcatgcttgttaacaacagccttcggttacctctggacacgattattatga
>gnl|bcl2dbcds|A0A2K6R5T5_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Rhinopithecus roxellana GN=BCL2L10 (length=696 residues).
atggctgacccgttgcgcgagcgcaccgagcggttgctggccgactatctggggtgctgcgcccgggaacccggcacccc
cgagccgaggccgtccacgcccgaggccgccgtgctgcgctccgcggcggccaggttacggcagctccaccggtccttct
tctctgcctacctcggctaccccgggaaccgcgtcgagctggtggcgctgatggcggaggccgtgctctccgacagcccc
ggccccacctggggcagggtggtgtcgctggtgaccttcgcggggacgctgctggagagagagccgctggtgacagcctg
gtggaagaagcggagcttccagccgcggctgaaggagcaggagggcgaggtcgcccgggactgccagcgcctggtggcct
tgctgagctcgcggctcacggggcagcaccgcgcctggcttcaggctcagggcggctgggtgagcacgcggcggacaccg
ggacgcggggcgggacgggcatccgggaagcgcccacgaggccggcacggatggcttttgtcacttcttcaggaccccct
ttccgctggctttttggagaaaactgctgatccaggctttcctggcatgcttgttaacaacagccttcggttacctctgg
acacgattattatgagttttaaaatttttaacccacttctacctgcccaactgtga
>gnl|bcl2dbcds|A0A2K6TIT7_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Saimiri boliviensis boliviensis GN=BCL2L10 (length=687 residues).
atggctgacccgctgcagcagcgcaccgagcagctggtggcggactacctggagtactgctcccgggagcccggcacccc
cgagtcgccaccggccacggccgaggccgctgtgctgcgcgccacggccgccgttgtacggaaactctacccgtccttct
tctccgcttaccgcggctaccccaggaaccgcgtcgagctggtggcgaggatggcggaggccttgctctccgacagtccc
ggtcccacctggggcaacgtggtgatgctcctggccttcgcggggacgctgctagagagggggccgctggtgaccgcccg
gtggaagaagtggggcttccagtcgcggttgaaggagccggagggcgacgtcgcccgggactgccagcgcctggtgggct
tgctgagctcgcggctcgtggggcagcaccgtgcctggctggaggctcagggcggctgggtgagcacgcggaggaggacg
tggggcgggatgggcacctgggaagggcccgccaggtggggtatttttctcctgtgcctattaaatgacctcctactcgc
tggcatggagaaaactgctggtcccggttttcctgtcatggttgttaacagcagcattcatctacttctggacacgataa
ttaggagttttaaaatttttagcccacttctgcctgcccaactgtga
>gnl|bcl2dbcds|A0A672JQE9_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Salarias fasciatus GN=BCL2L10 (length=585 residues).
atgtcgtgtgggctgcggagagagaccctggctctggcagaggactacctgtccctgcgctgcagaagcccatgtccggc
tcctccacctcccagcgagtcagccgctgccatgaggcacatggcccaggacctggagaagcagcaccaggctcgcttcc
agtccctggcccagaccttcctgaggcagtgcgggccggaccgctgcgtcagccttcggcaggtcatggaggagattgtc
ggagatggacacttgaactgggggagggttgtttccattttcacctttgctggggtggtggccagacttatgctggaaca
gaaagacgtcactaaggggctggaccccgggacgggtcaggaactgggacaagagaccgtaaactgcagggcactggcgg
agaccatagctgaatactttggaggggagaagaaagactggatgttggagaatgacggatgggagggcttctgtgcgtac
gcccgcactgccagacaggcgagcctggactcgtccatgaagacggcgctgttcgctgctgctggcgttggcctcgccgg
gctcaccttcctcctggtgcgctag
>gnl|bcl2dbcds|A0A8D0AGY2_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Sander lucioperca GN=BCL2L10 (length=582 residues).
atgtacgggctgtggaaagagaccctggctcttgcagaggactacctgtccctgtgctgcacaagcccacggccagcccc
tccacctcccagcgagtcagccgctgccatgagattcctggcccacgacatggagacgcagcaccaggctcgcttccaca
ccctcgctcagaccttcctgaagcactgtgggccggacctctgctccagcctcaggaaggtgatggaggagttggtggga
gacggacacttgaactgggggagggttgtttcccttttcacctttactggggtgctggccagacagctgatggagcagaa
gggcatgaagccggggctggactccggacaggggcaggaactgggacaggatcctggaaactgcagggcgctggctgaga
ccatagctgattacctgggagaggagaagaaagactggttcctggagaatgacggatgggaggggttctgtaaattctcc
gtcagtgccagagaggggagtcaggactcgtccatgaagacagcactgtttgctgctgctggtgtgggcctcgctggact
caccttcctcctggtgcgctag
>gnl|bcl2dbcds|A0A7N4P7T7_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Sarcophilus harrisii GN=BCL2L10 (length=561 residues).
atggagaccgaggatgcccttcgggaggagacgcggcggctggtgagcgactacctggagcactgctgccgtgcggaggg
ctgccaggaacgggcgccctccactccggccgcggccacgatgcgcgcggtggcccaggagctccgccggacttaccgcg
acttcttcgagtgcgccaagagtcagctgctcgaccagccgcccgagcgggtcatccccgaagtggcggagatgatggac
cagggcggcttcaactggggccgggtggcggtgctggtggtgtttgccggggcgatgctggagatggaggagcaggagaa
gcagcagcgagggcggctccggagcgagatgagccggcgcctggccgaggagctctgccactatctggtggagaagaagg
gcgcgtggctgcgggagaacggaggctggactggctttcaccaccacttcacccagaagcagcctcccccacaaagtgat
ccaaagagtaccctgtgctgtatagtggccgccgcaggatttggactggtgggattagctcttctattagccgtacgata
a
>gnl|bcl2dbcds|A0A8D2ARV4_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Sciurus vulgaris GN=BCL2L10 (length=555 residues).
atggcagacccgttgcaggagcgcacgttcaggctgctgagggactacctggagtactgcgcccgggagcctggcacccc
ggagccgccgccgtccacacccgaggcagccgtgctgcgctccgcggccgctcagttacaacggcaataccggcccttct
tctccctctaccgcgggtaccagggaaaccgcgtcgagctgatggcacggatgacagaggctgtgttttccgacagtcag
ggccttaactggggccatgtggtgacgcttgtgaccttcgcggggacgctactggagagagggccgcaggacaccgcccc
ggggcagaagaaggacaaagttgccctggactgccagcgtctcgtggccttgctatgtgctcagctcgtggggcggcacc
gcgcctggctggaggctcgtggtggctgggatggcttttgtctcttcttcaggacacccttaccgctaactttttggaga
agactgctagtccagatttttatgttgctccttttagcaactgccttcctctgtttatggaaacgattacaaaaa
>gnl|bcl2dbcds|A0A8D3DY18_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Scophthalmus maximus GN=BCL2L10 (length=579 residues).
atgtcctgtgggctgtggaaagagaccctggctctggcggaggactacctgtccctctgctgcaagagcccgcggccagc
cccctcgcctcccagcgagtcagccgccgccatgagacgcctggcccgggacatggagaagcagcaccaggctcgcttcc
acgcgctcgcccaggccttcctgcggcagtgcgggccggacccctgcaccagcctcagggcggtgatggaggagctggcg
ggagacggacacttgaactggggcagggtcatctccattttcaccttcgccggggtggtggtcaggcagctgctggagca
ggagggcctgaagccggggctggaccccgggcaggagctggcacaggggcccgggagctgcaggggactggcagagacca
tagccgattacctgggagaggagaagaaggactggctgctggagaacgatggatgggatgggttctgtaagttctcccgc
agtgccagagagatgagccaggactcgtcgatgaagacggctctgtttgctgctgctggcgtggggcttgccggactcac
cttcctgctggtgcgctag
>gnl|bcl2dbcds|A0A3B4TIY6_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Seriola dumerili GN=BCL2L10 (length=573 residues).
atgtcatgcgggctgtggaaagagacccgggctgtggcagaggactacctgtatctttgctgcacaagcccacagccagc
ccctccacctcccagcgaatcagccgctgccatgagaagtatggcccaagacatggagacgcagcaccaggctcgcttcc
acacccttgctcaaaccttcgtaacgcagtgtgggctggacccctgctccagcctcaggaaggtgatggaggagctggtg
ggagatggacacttgaactgggggagggttgtttccattttcacctttactggggtgctggccagactgctgctggagca
gaaccgtgtgaacccggggctggaccctgggcagggacaggggctcggaaactgcaggggactggcagagaccatagctg
attacctgggagaagagaagaaagactggctgctggagaacggtggatgggaggggttctgtaaattctcccacagtgcc
agagaggtgagccaggacttgtcgatgaagacagcactgtttgctgctgctggtgtgggcctcgctggactcacctttct
cctggtgcgctag
>gnl|bcl2dbcds|A0A3B4WGF4_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Seriola lalandi dorsalis GN=BCL2L10 (length=573 residues).
atgtcatgcgggctgtggaaagagacccgggctgtggcagaggactacctgttcctttgctgcacaagcccacagccagc
ccctccacctcccagcgaatcagccgctgccatgagaggcatggcccaagacatggagacgcagcaccaggctcgcttcc
acacccttgctcaaacctttgtaacgcagtgtgggctggacccctgctccagcctcaggaaggtgatggaggagctggtg
ggagatggacacttgaactgggggagggttgtttccattttcacctttactggggtgctggccagactgctgctggagca
gaaccgtgtgaacccggggctggaccctgggcagggacaggggctcagaaactgcaggggactggcagagaccatagctg
attacctgggagaagagaagaaagactggctgctggagaacggtggatgggaggggttctgtaagttctcccacagtgcc
agagaggtgagccaggacttgtcgatgaagacagcactatttgctgctgctggtgtgggcctcgctggactcacctttct
cctggtgcgctag
>gnl|bcl2dbcds|A0A671XUH4_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Sparus aurata GN=BCL2L10 (length=615 residues).
atgtgcagagagcagtctgatatcgctgggaggaaaatgtcgtgcgggctgtggaaagagaccctggctctggcagagga
ctacctgtccctgtgctgcacaagcccccggccagcccctccacctcccagcgagtcagccgctgccatgaggtgcatgg
cccaggacatggaggcgcagcaccaggctcgcttccactccctcgcccagaccttcctgaggcagtgcgggcctgacccc
tgctccagcctcaggaaggtgatagaggagctggtgggagatggacacttgaactgggggagggttgtttcccttttcac
ctttactggggtgctggccagacagctgcaggagcagaaggacaagaagccggggctggaacccgggcaggaactgggac
aggggcctggaaactgcaggggactggcagagaccatagctgattacctgggagaggagaagaaagagtggctgctggag
aatgacggatgggaggggttctgtaagttctcccgcagtgccagagaggtgagtcaggaatcgtccatgaagaaagcgct
gtttgctgccgctggtgtaggcatcgctggactcaccttcctcctggtgcgctag
>gnl|bcl2dbcds|A0A672YCF8_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Sphaeramia orbicularis GN=BCL2L10 (length=633 residues).
atgaagcgaggttctccttccgccgtccttatgtgcagagagcagactgatatcgctgggaggaaaatgtcctgtgggct
gtggaaagagaccctggctatggcagaggactacatggccctgtgctgcacaggcccacaggcggcccctccacctccca
gcgagtcagctgctgccatgaggctcctggcccaggacgtggagaggcagcaccaggctcggttcctctccctcgctcag
accttcctgaggcagtgtgggccggaaccctgttccagcctcaggaaggtgatggaggagctggtgggcgatggacactt
aaactggggaagggttgtgtcccttttcacctttactggggtgctggccagacagctgatggagcagaagggcacgaaac
cggggctggaccctcaacaggtgcctggaaattacaggggattggcagaaaccatagctgattacctgggagaggagaag
aaagactggctgctggagaatgatggctgggaggggttctgtaagttctcccatcatgccagaaaagtgagtcaggactc
gtccatgaagaaagctctgtttgctgctgctggggtcggcctcgctggactcaccttcctcctggtgcgctag
>gnl|bcl2dbcds|A0A3B4ZFS0_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Stegastes partitus GN=BCL2L10 (length=585 residues).
atgtcctgtgggctatggaaagagaccttggttgtggcagaggactacctgtccctgtgctgcacaagcccacattcagc
ccctccacctcccagcgagtcagccgctgccatgaggtgcctggcccaggacatggagaagcagcaccaggctcgcttcc
actccctcactcagaccttcctgaggcagcccgggccggacctctgctccagcctcaggagggtgatggaggagctggtg
ggagatggacacttgaactgggggagggttgtttcccttttcacctttactggggtgctggccagacagctgcaggagca
gagggacacgaagccggggctggaacccgggaagcggcaggaactgggacaggggcccgtaaactgcaggggactggcag
agaccatagctgattacctgggagaggagaagaaagactggctgttggagaacgatggatgggaaggcttcgttaagttc
tccctcagtgccagagaggtgagtcaggacttgtccatgaagacagcgctgtttgctgctgctggtgtcggcctcgctgg
actcaccttcctcctggtgcgctag
>gnl|bcl2dbcds|A0A673UC80_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Suricata suricatta GN=BCL2L10 (length=579 residues).
atggctgacccgttgagagagcgtactgcgcgattattaacggacttcctggagtactgcgctcgggcccccggcagccc
cgcgcgggcgccgtccacgcccgaggctgaagtgctgcgctacgtggccacccaagtacaacagagccaccagcaattct
tgtcgaatttccgcggctaccgccagaaccgcgttgcgctagtggggcggttggagcggtatttactccccgacccccaa
aacgtcagctggggctatatagcagcgctgttgatcttcgcggggacgctgctggagaggccgccaccagggaacgactt
gaccctgaagccggaccaggaacaggacctggagtgggagaccaacgttgaccaggactgccagcgcctggtggctttgc
tctgcgatcggcttatggaacggcatcgcgcctggctggaggcgcacaatggctgggatggcttttgtctcttcttctca
cccctgctgccatattcttggaaaacattgctggtccaggctcttctgtcatgcgttacagtaatgatcttaatctacct
cttgagaagattatcatga
>gnl|bcl2dbcds|A0A4X1T1Z2_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Sus scrofa GN=BCL2L10 (length=519 residues).
atggcggacgcgttcagggagcgcacagcccggcttctgaccgactacctggagtactgcgcccgggagcccggcaccgc
cgcgcggcagccgtcctcgcccgaggccgcagtgctgcgttgcgtggctgcccagatacgggagtacaacgtgcgcacct
tgtctgtctaccgcggcttccgctggaaccgtgtcgaattggtggcctggatggcacagaaactactcgcaagcccacgt
ggccccaactggtaccgcgtggcatcactcttgaccttcgcagggatgctgctggaaagacatcctcggagcagggactg
ccgactcctggtggctttgctgtgcgctcagctctcagggcagcatcgcacctggctattggcgaacggcggctgggatg
gattttgtctcttcttccaaggctcattgcaacaaacttggacaagacacatggtctgggtttttgtgtcatactgtaca
gcagtggtcttactctacttgtggagaaaattattgtga
>gnl|bcl2dbcds|A0A8D1ITC0_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Sus scrofa GN=BCL2L10 (length=555 residues).
atggcggacgcgttcagggagcgcacagcccggcttctgaccgactacctggagtactgcgcccgggagcccggcaccgc
cgcgcggcagccgtcctcgcccgaggccgcagtgctgcgttgcgtggctgcccagatacgggagtacaacgtgcgcacct
tgtctgtctaccgcggcttccgctggaaccgtgtcgaattggtggcctggatggcacagaaaaaactcgcaagcccacgt
ggccccaactggtaccgcgtggcatcactcttgaccttcgcagggatgctgctggaaagacatcctcgggaggcctgtgg
gcggaagaagaaggagggcaacgttagcagggactgccgactcctggtggctttgctgtgcgctcagctctcagggcagc
atcgcacctggctattggcgaacggcggctgggatggattttgtctcttcttccaaggctcattgcaacaaacttggaca
agacacatggtctgggtttttgtgtcatactgtacagcagtggtcttactctacttgtggagaaaattattgtga
>gnl|bcl2dbcds|A0A8D1N411_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Sus scrofa GN=BCL2L10 (length=567 residues).
atggcggacgcgttcagggagcgcacagcccggcttctgaccgactacctggagtactgcgcccgtgagcccggcaccgc
cccgcggcagccgtcctcgcccgaggccgcagtgctgcgttgcgtggctgcccagatacgggagtacaacgtgcgcacct
tgtctgtctaccgcggcttccgctggaaccgtgtcgaattggtggcctggatggcacagaaactactcgcaagcccacgt
ggccccaactggtaccgcgtggcatcactcttgaccttcgcagggatgctgctggaaagacatcctcgggaggcctgtgg
gcggaagaaggagggcaacgttagcagggactgccgactcctggtggctttgctgtgcgctcagctctcagggcagcatc
gcacctggctattggcgaacggcggctgggtggattctttcttcaatgctattaggtacacctttccacttgactccgca
gctctgcaggttggagcacaccagcctaaaaactttaggatgaaaaggcagcccttgtcctgctccacatctctaagaaa
gggctga
>gnl|bcl2dbcds|A0A8D1QEZ6_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Sus scrofa GN=BCL2L10 (length=555 residues).
atggcggacgcgttcagggagcgcacagcccggcttctgaccgactacctggagtactgcgcccgggagcccggcaccgc
cgcgcggcagccgtcctcgcccgaggccgcagtgctgcgttgcgtggctgcccagatacgggagtacaacgtgcgcacct
tgtctgtctaccgcggcttccgctggaaccgtgtcgaattggtggcctggatggcacagaaactactcgcaagcccacgt
ggccccaactggtaccgcgtggcatcactcttgaccttcgcagggatgctgctggaaagacatcctcgggaggcctgtgg
gcggaagaagaaggagggcaacgttagcagggactgccgactcctggtggctttgctgtgcgctcagctctcagggcagc
atcgcacctggctattggcgaacggcggctgggatggattttgtctcttcttccaaggctcattgcaacaaacttggaca
agacacatggtctgggtttttgtgtcatactgtacagcagtggtcttactctacttgtggagaaaattattgtga
>gnl|bcl2dbcds|A0A3B5KD08_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Takifugu rubripes GN=BCL2L10 (length=585 residues).
atgtcgtgcgggctgtggaaagagaccctggctcttgcagaggactacctgtccctgtgcagcacaagccagtgtccagc
ccctccacctcccagcgagtcggccactgccatgaggcacctgggtcaggacatggagaagcagcaccaggctcggttca
actccctagctcagaccttcctgagacagtgcgggccggacctctgctccagcctcaggaaagtgatggaggagctggtg
ggagatggacacttgaactggggaagggttgtatcccttttcacctttactggggtgctggccagactgatgcaggagca
gaagagcacaaagccggggctggaccctggacaagagcagcaactgggacaggtgcccgaaaactgcaggggactcgcgg
agaccatagcagactatctaggagaggagaagaaagactggctgctggagaatggcggatgggaggggttctgtaagtac
tccctcgctgccagggaggtgaatcacgactcgtccatgaagaccgcactgttcgccgctgccggggtcggtctcgccgg
gctcacgttcctcctggtgcgctag
>gnl|bcl2dbcds|A0A8D2FBM7_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Theropithecus gelada GN=BCL2L10 (length=585 residues).
atggctgacccgttgcgggagcgcaccgagcggctcctggccgactatctggggtgctgcgcccgggaacccggcacccc
tgagccaaggccgtccacgcccgaggccgccgtgctgcgctcagcagccgtcaggttacggcagctccaccggtccttct
tctccgcctaccgcggctaccctgggaaccgcgtcgagctggtggcgctgatggcggaggccgtgctctccgacagcccc
ggccccacctggggcagggtggtgtcgctggtgaccttcgcggggacgctgctggagagagagccgctggtgacagcctg
gtggaagaagcggagcttccagccgcggctgaaggaacaggagggcgacgtcgcccgggactgccagcgcctggtggcct
tgctgagctcgcggctcgcggggcagcaccgcgcctggcttcaggctcagggcggctgggatggcttttgtcacttcttc
aggagcccctttccgctggctttttggagaaaactgctgatccaggctttcctggcatgcttgttagcaacagccttcgg
ttatctctggacacgattattatga
>gnl|bcl2dbcds|A0A8D2H6G4_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Urocitellus parryii GN=BCL2L10 (length=555 residues).
atggcagacctgctgcaggagcgcaccgcccagctgctgaccgactacctggagtactgtgcccgggagccgggcacccc
cgagccgccgccgtccactcccgaggccgccgtgctgcgctctgcggccacccrgttacaacagcgatacgagcccttct
tctccctttaccgcgggcacccaggtaaccgcgtcgagctgatggcacagatggcagaggctgttctttccgacaaccag
gccctcaactggggccgtgtggtgatgcttgtgaccttcgcagggacgttgctggagagaaagccgcaggacacccacgg
gccgcacacgcgggaccaagctgccctggacagtcggcgtctcgtggacttgctctgtgctcagctcgtggggcggcacc
gcgcctggctggaggctcaaggcggctgggatggcttttgtgacttctttaggacacccttgccactaacgttttggaga
aatcttctggtccagatttttatgtcgtgccttttagcaactatcttcatctatttctgcacacgattttatcga
>gnl|bcl2dbcds|A0A452QJG0_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Ursus americanus GN=BCL2L10 (length=594 residues).
atggcggacgcgctgagggagcgcacggcgcggctgctgaccgactacctggagtactgcgcccgggagcccggcacccc
tgcgcgggcgccgtccacgcccgaggccgcggtgctgcgctcggtggccgcccaggtccagcagcgtcacgagcacttct
tgtccgattaccgcggctacggcggcaaccgcgtggagctggtggctcaggtggagcgggagatactcgcccacccccag
cccctaagctggggccgtgtggtggcgctcctcaccttcgcgggcacactgctggagagatcgccgtcggggacctactc
gaacctggggccggaccaggaactggagctgggggagcgggaggccggcgtccgccaggactgccggcacctggtggact
tcctctgcaatcggctcacgggacagcatcgcgcctggctggaggcgcacgacggctgggtgaatggcttttgtctcttc
ttcacacccatgctggccgtccgtcttggaaaagactgctggcccaggctcttctgtcctgcttcacaggcagtgatctt
aatctacttctggaaaagattatgtgagttctga
>gnl|bcl2dbcds|A0A4X2K2M5_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Vombatus ursinus GN=BCL2L10 (length=567 residues).
atggactacaagtgtgcccttcgggaagagacagcgcaacttgtggcggactacctggattactgctgccgccgggaagg
cttccaggaacggccgcctactaccccagctgcagctacgatgcgctcggtggcaaaagagctccgcaggcgttaccaag
acttcttcgagtgcgcccagaatcagctactcgaccagtcgcctgaacaagtcataatcgaggtagcggagctcatgagc
cagggcgaattcaactggggccgggtggcagtgctggtggtttttgccggggcactgctggagatggaggaaccgcagaa
agaggagagagtacagccgcttcggagggaaatgagccggcgcttgacggaagaactctgcaactatctggtggagaaga
agggcgcgtggctgcaggagcacggaggctggactggctttcaccaccacttcacccaaaagcagtcttccccacaaagt
gatccaagcagtaccctgtgctgtataatggccgcagcagcaggatttggactggtgggattagctcttctattagccgt
acgataa
>gnl|bcl2dbcds|A0A3B5MJ12_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Xiphophorus couchianus GN=BCL2L10 (length=585 residues).
atgtcctgtgggctgtggaaagagaccgtggttgttgcagaggattacatccgcctgcgctgctcaagcccacacccagc
ccctccacctcccagcgagccggccgccgccatgaggcgcctggcccaggacgtggaggccaagcaccaggctcgctttc
actccctggcccagggcttcctgaagcactgcgggtcggacctctgctccaacctcagaaaggtgatggatgagatggtg
ggggacggacactttaactgggggagggtggtgtccctcttcgccttcgccggcgtgctggccagacagctgcgggaaca
gacgggcaagaacccggtgccggactccgggaagcagcaggaactgcaacaagagcccgtaagctgccgggcgctggcgg
agaccattgctgattacctggagaagcacaaaaaggactggctacaggaaaataatggatgggaagggttttgtagctat
gcccgcaacgccagagaagcaagtcaggactcctccatgaagacggcgctggttgctgtcgccggggtcggcatcgctgg
actcaccttcctcctggtgcgctag
>gnl|bcl2dbcds|M4AUW7_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Xiphophorus maculatus GN=BCL2L10 (length=585 residues).
atgtcctgtgggctgtggaaagagaccgtggttgttgcagaggattacatccgcctgcgctgctcaagcccacacccagc
ccctccacctcccagcgagccggccgccgccatgaggcgcctggcccaggacgtggaggccaagcaccaggctcgctttc
actccctggcccagggcttcctgaagcactgcgggtcggacctctgctccaacctcagaaaggtgatggatgagatggtg
ggggacggacactttaactgggggagggtggtgtccctcttcgccttcgccggcgtgctggccagacagctgcgggaaca
gacgggcaagaacccggtgccggactccgggaagcagcaggaactgcaacaagagcccgtaagctgccgggcgctggcgg
agaccattgctgattacctggagaagcacaaaaaggactggctacaggaaaataatggatgggaagggttttgtagctat
gcccgcaacgccagagaagcaagtcaggactcctccatgaagacggcgctggttgctgtcgccggggtcggcatcgctgg
actcaccttcctcctggtgcgctag
© 1998-2023Legal notice