Dataset for CDS BCL2L1 of organism Salmo salar

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


C0HAD8_BCL2L1-01        ---atgtcttacagtaacagggaactggtggtgttttttataagctatag
A0A1S3MED7_BCL2L1-      ---atgacttacaacaacagagaactggtggtatactatattacctataa
B5XAY3_BCL2L1-01        atgatgacttacaacaacagagaactggtggtgtactatattacctataa
                           *** ******  ***** *********** *  * *** * ***** 

C0HAD8_BCL2L1-01        actgtcccagaggaattattcatgttgtcaattggggctggagggtgcaa
A0A1S3MED7_BCL2L1-      actatcacagagagactaccccttcaaccacattgggctcacagaagctc
B5XAY3_BCL2L1-01        actatcacagagggactaccccttcaaccacatggagctcacggaagccc
                        *** ** *****  * **  * *     **  * * ***    *  **  

C0HAD8_BCL2L1-01        gtggacggactgagg--------------gagatgacgccatt-------
A0A1S3MED7_BCL2L1-      ccagtcggactgaggggggacaggcggaagggggggcggcagtcacgaca
B5XAY3_BCL2L1-01        agaatcggactgaggtgggacaggtggaagggggtgcggcagtcctaaca
                             **********              * *    ** ** *       

C0HAD8_BCL2L1-01        ---------------gcaaatgggtc---tgtgggga----acagcagaa
A0A1S3MED7_BCL2L1-      caccccaacggcgcagcgaacgggacgagtcctgggact---ccaccgcg
B5XAY3_BCL2L1-01        tac------------gtcaacgggacgagtcccgggactccaccaccacg
                                       *  ** *** *   *   ****     *  *    

C0HAD8_BCL2L1-01        gcaatttggcgaagccctcatctccacaggg------gggcatggagcca
A0A1S3MED7_BCL2L1-      acagtctccc----ccctcgtcccctcagcggacaatgggcctggacgca
B5XAY3_BCL2L1-01        gcagtcgccc----ccctcctcccctcggcggacagcgggcctggacgca
                         ** *    *    ***** ** ** * * *      **** ****  **

C0HAD8_BCL2L1-01        gtgaaagcagcactacgggactcagtggatgagtttgagctgcgctacac
A0A1S3MED7_BCL2L1-      gtgaaagaggcattgcgggactctgccaacgagtttgagctgcgttatgc
B5XAY3_BCL2L1-01        gtgaaagaggcattgcgggactctgccaacgagtttgagctgcgttatgc
                        *******  *** * ******** *   * ************** **  *

C0HAD8_BCL2L1-01        ccgcgccttcagtgacctctcctcccagctccacatcacccctgccacag
A0A1S3MED7_BCL2L1-      cagagcgttcagtgacctgtcctcccagctgcacatcacgccggccacag
B5XAY3_BCL2L1-01        cagagcgttcagtgacctgtcctcccagctacacatcacgccgtccacag
                        * * ** *********** *********** ******** **  ******

C0HAD8_BCL2L1-01        cctaccacagctttgagagtgtgatggacgaagtgttcagggacggggtc
A0A1S3MED7_BCL2L1-      cctaccagagcttcgagaacgtgatggatgaggttttccgtgacggtgtg
B5XAY3_BCL2L1-01        cctaccagagctttgagaacgtgatggacgaggtgttccgggacggtgtc
                        ******* ***** ****  ******** ** ** *** * ***** ** 

C0HAD8_BCL2L1-01        aactggggtcgcgtggtgggtctgtttgctttcggcggggccttgtgtgt
A0A1S3MED7_BCL2L1-      aactggggacgtgtggtgggcctgtttgccttcggaggggccctctgtgt
B5XAY3_BCL2L1-01        aactggggacgggtggtgggcctgttttccttcggaggggccctctgtgt
                        ******** ** ******** ****** * ***** ****** * *****

C0HAD8_BCL2L1-01        tgagtgtgttgagaaggatatgagcccactggtggcgcgcatcgcagact
A0A1S3MED7_BCL2L1-      agagtgtgtggagaaggagatgagcccactagtgggacggattgcagact
B5XAY3_BCL2L1-01        agaatgtgtggacaaggagatgaaccccttggtgggaaggatcacagact
                         ** ***** ** ***** **** ***  * ****   * **  ******

C0HAD8_BCL2L1-01        ggatgaccacctacctggacaaccatatccagccctggatccagagccaa
A0A1S3MED7_BCL2L1-      ggatgactgtctacctggacaaccacatccaaccctggatccagagccaa
B5XAY3_BCL2L1-01        ggatgaccgtctacctggacaaccacatccagccctggatccagagccaa
                        *******   *************** ***** ******************

C0HAD8_BCL2L1-01        ggaggatgggaccgttttgcagagatctttggcagagatgctgctgcaga
A0A1S3MED7_BCL2L1-      ggaggatgggaccggtttgcagaaatctttgggaaggacgctgcagctga
B5XAY3_BCL2L1-01        ggaggatgggaccggtttgcagagatctttggaatggacgctgcagccga
                        ************** ******** ******** *  ** ***** ** **

C0HAD8_BCL2L1-01        cgttcgacggtctcaggagagcataattaaatggctgctagttggggtga
A0A1S3MED7_BCL2L1-      gagcaggaagtctcaggagaactttaagaagtggttgctggcggggatga
B5XAY3_BCL2L1-01        gagcaggaagtctcaggagagctttaagaagtggcttctggcagggatga
                             *   *********** * * *  ** *** * ** *  *** ***

C0HAD8_BCL2L1-01        ttctgctttcaggagtgctggtcggcactctcatcatgaagaaacgccag
A0A1S3MED7_BCL2L1-      cgctggttacaggagtcatcgtagggtcactcattgctcagaaacgcctg
B5XAY3_BCL2L1-01        ccctggtcacaggagtcgtcgtagggtcactcttcgctcagaaacgcctg
                          *** *  *******  * ** **  * *** *     ********* *

C0HAD8_BCL2L1-01        tga
A0A1S3MED7_BCL2L1-      tga
B5XAY3_BCL2L1-01        tga
                        ***

© 1998-2021Legal notice