Dataset for CDS Unclassified of organism Salmo trutta

[Download (right click)]

5 sequence(s)

>gnl|bcl2dbcds|A0A673XRF5_uncBCL2L10-01 Putative BCL2-like 10 gene OS=[Eukaryota] Salmo trutta (length=651 residues).
atgacagcgatcctccttccgtctgtacgtggagaaagcagtctgatcgctgggaggaccatgtcatgcgggctgtggaa
agaaaccctggctatagcagaggactacctgtctgtctgcagtatcatccctgccagtgggtcccggaaagccccgcccg
gtcctcctcctagcgactctgctgcagccatgcggcgccaggcccgggacatggaggccaagcaccgggcccgcttccac
gccctggcacacagcttcctgtgccaatgcgggccagacccctgcgcctgtctgaggagggtgatggaggagctggtggg
agacggacagatgaactgggggagggtggtctctctgttcaccttcactggtgtgctggtcagagaactacagggagagg
acaaggaccaggggctgggtaatggcatgggcctgggggggaaggagagctgcagggcgctggcggggaccatagcagac
tacctaggagaggagaagagtgactggatgctggagaacaaaggctgggagggcttctgtaagttcttccacacagcaag
agaggtgaaccaggactcgtccatgaagactgccctgtttgctgctgctggcgtgggcatcgcagggttaaccttcctcc
tggtccgctaa
>gnl|bcl2dbcds|A0A673Y348_uncMCL1-01 Putative Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Salmo trutta (length=576 residues).
ccactgtgttgtctgcagcaccctcaccatccagggaagatatcacatcaggaaacataccatcaccagaccggagccct
ggacatagacaccaggcaactcattaaatgtgtcctaggacaatgtacgggacttctgaaacctaggtggaacgaaagca
aagctctgtcaacaacgagtagagttatcgggcaattactggagaagcacagatacacatacaacggtatgatcaacaca
ctctatgtggatgacagaggggatgacgtgaagttcctcagttcagtagcccatatcatctttgaagacgggaccgtcaa
ctggggccgtgttgccagcctgatgtcttttggggctgcggtgtgccagtacttgagaggcaaggggagagacgactgtg
ttgacgtggtgggagaagagatagcagagtacctggccactcaccacacggactggctaaatgggttcgcggagttcttt
ctagtagcagaacctgagtccagatgtaggaacatcatcatgacccttttcggattggccggtattggcgcaacaatgac
cttcttggttatgtga
>gnl|bcl2dbcds|A0A674BFJ1_uncMCL1-01 Putative Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Salmo trutta (length=753 residues).
atgctgaggttccaaagcgggctgctagcattccccgagttcaagttgtactcgaatgttgggtacgttacaatcgcagg
tacaaaacattgcattatctgtgcatcgccaccaggccaagatcattacatcgcgtgccctgagattggtaacctcctca
agacaaagttgaagcatctgaaactgtcagggtctatcgacagcactcctttgttcactaggagaggacccggacatgag
tacagctggggagccctggacaccgacaccaggcaactcattaaatgtgtcctaggacaatgtacgggacttctgaaacc
taggtggaacgaaagcaaagctctgtcaacaatgagtagagttgttggtcaattactggagaagcacagatacacataca
atggtatgatcaacacactctatgtggatgacagaggggatgacgtgaagttcctcagtgcagtagcccatatcatcttt
caagacgggaccgtcaactggggccgtgttgccagcctgacatcttttggagctgcggtgtgccagtacttgaaagacaa
ggggagagacaactgtgtggaggtggcgggagaggagatatcagcgtacctggtcactcaccacaaggactggctaaatg
ggttcgtggagttctttccagtagcagaaccggagtccagatctaggaacattattatgacccctgttggattggctggt
attggagcagcaatgaccttgttggttatgtga
>gnl|bcl2dbcds|A0A674C6K2_uncBCL2L10-01 Putative BCL2-like 10 gene OS=[Eukaryota] Salmo trutta (length=651 residues).
atgacagcgatcctccttccgtcggtacgtggagaaagcagtctgatcgctgggaggaccatgtcatgcgggctgtggaa
agaaaccctggctatagcagaggactacctgtctgtctgcagtatcatccctgccagtgggtcccggaaagccccgcccg
gtcctcctcccagcgactctgctgcagccatgcggcgccaggcccgggacatggaggccaagcaccgggcccgcttccac
gccctggcacacagcttcctgtgccaatgcgggccggacccctgcgcctgtctgaggagggtgatggaggagctggtggg
agacggacagatgaactgggggagggtggtctctctgttcaccttcactggtgtgctggtcagagaactacagggagagg
acacggaccaggggctgggtaatggcatgggcctgggggggaaggagagctgcagagcgctggcggggaccatagcagac
tacctaggagaggagaagagtgactggatgctggagaacaaaggctgggagggcttctgtaagttcttccacacagcaag
agaggtgaaccaggactcgtccatgaagactgccctgtttgctgctgctggcgtgggcatcgcagggttaaccttcctcc
tggtccgctaa
>gnl|bcl2dbcds|A0A674EJX0_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Salmo trutta (length=588 residues).
atggcaaacgacgacaaccgctgtatagtggaaaagtacatttgtcacaaactcttgaaaaggggatatgcgtgggattt
cgagaatgccgaggatgaggaagatgctgataataatgggtcgatgatttctcctccgcctgctattcacagagttttgc
gtgaggccggggacgaactcgaacgactgtaccagcccgactttgcggagatgtcacaccaattgtatctcacgtcttct
atggcagaaaggagattcagagaggtgatagacgagctgttcagggacggggttaactggggacgaattgtcgccttctt
cgagttcgggggcacaatatgtgtggaatgcgtgaacaaggaaatgacgtcgcaggttgaccacatcgccgggtggatga
cggagtatctaaatggaccactgcacagctggattcaagagaacgggggatgggaggcctttgttgagctctatgacaga
cagagggactccatgttctgttcgtggccgtccatcaagactgtctttggcctggctgcactgggggccgcaagccttac
catcggagcttaccttacacagaagtga
© 1998-2020Legal notice