Dataset for CDS BAX of Organism Ailuropoda melanoleuca

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|A0A7N5J9E6_BAX-01 BCL2-associated X gene OS=[Eukaryota] Ailuropoda melanoleuca GN=BAX (length=579 residues).
atggacgggtccggggaacaacccagaggcggggggcccaccagctctgagcagatcatgaagacaggggcccttttgct
tcagggtttcatccaagatcgagcagggcgaatggggggagagacacctgagctggccctggagcaggtgccccaggacg
catccaccaagaagctgagcgagtgtctcaaacgcatcggagatgaactggacagtaacatggagttacagaggatgatc
gcagccgtggacacagactccccgcgcgaggtctttttccgagtggcagctgacatgttttccgatggcaacttcaactg
gggccgggttgttgccctcttctactttgccagcaaactggtgctcaaggccctgtgtaccaaggtgcccgagctgatca
ggaccatcatgggctggacactggacttccttcgagagcggctgctgggctggatccaggaccagggtggttgggacggc
ctcctctcctactttgggacacccacgtggcagacagtgaccatctttgtggctggagtgctcactgcgtcactcaccat
ctggaaaaagatgggctga
>gnl|bcl2dbcds|A0A7N5J9E6_BAX-02 BCL2-associated X gene OS=[Eukaryota] Ailuropoda melanoleuca GN=BAX (length=432 residues).
atggacgggtccggggaacaacccagaggcggggggcccaccagctctgagcagatcatgaagacaggggcccttttgct
tcaggggatgatcgcagccgtggacacagactccccgcgcgaggtctttttccgagtggcagctgacatgttttccgatg
gcaacttcaactggggccgggttgttgccctcttctactttgccagcaaactggtgctcaaggccctgtgtaccaaggtg
cccgagctgatcaggaccatcatgggctggacactggacttccttcgagagcggctgctgggctggatccaggaccaggg
tggttgggacggcctcctctcctactttgggacacccacgtggcagacagtgaccatctttgtggctggagtgctcactg
cgtcactcaccatctggaaaaagatgggctga
>gnl|bcl2dbcds|A0A7N5J9E6_BAX-03 BCL2-associated X gene OS=[Eukaryota] Ailuropoda melanoleuca GN=BAX (length=618 residues).
atgagccaccctagttccctggatcccctaggacccaagagtccaggcacctcttccctcctttctcctctagggcccac
cagctctgagcagatcatgaagacaggggcccttttgcttcagggtttcatccaagatcgagcagggcgaatggggggag
agacacctgagctggccctggagcaggtgccccaggacgcatccaccaagaagctgagcgagtgtctcaaacgcatcgga
gatgaactggacagtaacatggagttacagaggatgatcgcagccgtggacacagactccccgcgcgaggtctttttccg
agtggcagctgacatgttttccgatggcaacttcaactggggccgggttgttgccctcttctactttgccagcaaactgg
tgctcaaggccctgtgtaccaaggtgcccgagctgatcaggaccatcatgggctggacactggacttccttcgagagcgg
ctgctgggctggatccaggaccagggtggttgggacggcctcctctcctactttgggacacccacgtggcagacagtgac
catctttgtggctggagtgctcactgcgtcactcaccatctggaaaaagatgggctga
© 1998-2023Legal notice