Dataset for CDS BAX of organism Ailuropoda melanoleuca

[Download (right click)] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.8) multiple sequence alignment


A0A7N5J9E6_BAX-02      atggacggg-------------tccggggaacaacccagaggcg------
A0A7N5J9E6_BAX-01      atggacggg-------------tccggggaacaacccagaggcg------
A0A7N5J9E6_BAX-03      atgagccaccctagttccctggatcccctaggacccaagagtccaggcac
                       ***  *                  *    *  * ** **** *       

A0A7N5J9E6_BAX-02      --------------------gggggcccaccagctctgagcagatcatga
A0A7N5J9E6_BAX-01      --------------------gggggcccaccagctctgagcagatcatga
A0A7N5J9E6_BAX-03      ctcttccctcctttctcctctagggcccaccagctctgagcagatcatga
                                             ****************************

A0A7N5J9E6_BAX-02      agacaggggcccttttgcttcagg--------------------------
A0A7N5J9E6_BAX-01      agacaggggcccttttgcttcagggtttcatccaagatcgagcagggcga
A0A7N5J9E6_BAX-03      agacaggggcccttttgcttcagggtttcatccaagatcgagcagggcga
                       ************************                          

A0A7N5J9E6_BAX-02      --------------------------------------------------
A0A7N5J9E6_BAX-01      atggggggagagacacctgagctggccctggagcaggtgccccaggacgc
A0A7N5J9E6_BAX-03      atggggggagagacacctgagctggccctggagcaggtgccccaggacgc
                                                                         

A0A7N5J9E6_BAX-02      --------------------------------------------------
A0A7N5J9E6_BAX-01      atccaccaagaagctgagcgagtgtctcaaacgcatcggagatgaactgg
A0A7N5J9E6_BAX-03      atccaccaagaagctgagcgagtgtctcaaacgcatcggagatgaactgg
                                                                         

A0A7N5J9E6_BAX-02      ---------------------ggatgatcgcagccgtggacacagactcc
A0A7N5J9E6_BAX-01      acagtaacatggagttacagaggatgatcgcagccgtggacacagactcc
A0A7N5J9E6_BAX-03      acagtaacatggagttacagaggatgatcgcagccgtggacacagactcc
                                            *****************************

A0A7N5J9E6_BAX-02      ccgcgcgaggtctttttccgagtggcagctgacatgttttccgatggcaa
A0A7N5J9E6_BAX-01      ccgcgcgaggtctttttccgagtggcagctgacatgttttccgatggcaa
A0A7N5J9E6_BAX-03      ccgcgcgaggtctttttccgagtggcagctgacatgttttccgatggcaa
                       **************************************************

A0A7N5J9E6_BAX-02      cttcaactggggccgggttgttgccctcttctactttgccagcaaactgg
A0A7N5J9E6_BAX-01      cttcaactggggccgggttgttgccctcttctactttgccagcaaactgg
A0A7N5J9E6_BAX-03      cttcaactggggccgggttgttgccctcttctactttgccagcaaactgg
                       **************************************************

A0A7N5J9E6_BAX-02      tgctcaaggccctgtgtaccaaggtgcccgagctgatcaggaccatcatg
A0A7N5J9E6_BAX-01      tgctcaaggccctgtgtaccaaggtgcccgagctgatcaggaccatcatg
A0A7N5J9E6_BAX-03      tgctcaaggccctgtgtaccaaggtgcccgagctgatcaggaccatcatg
                       **************************************************

A0A7N5J9E6_BAX-02      ggctggacactggacttccttcgagagcggctgctgggctggatccagga
A0A7N5J9E6_BAX-01      ggctggacactggacttccttcgagagcggctgctgggctggatccagga
A0A7N5J9E6_BAX-03      ggctggacactggacttccttcgagagcggctgctgggctggatccagga
                       **************************************************

A0A7N5J9E6_BAX-02      ccagggtggttgggacggcctcctctcctactttgggacacccacgtggc
A0A7N5J9E6_BAX-01      ccagggtggttgggacggcctcctctcctactttgggacacccacgtggc
A0A7N5J9E6_BAX-03      ccagggtggttgggacggcctcctctcctactttgggacacccacgtggc
                       **************************************************

A0A7N5J9E6_BAX-02      agacagtgaccatctttgtggctggagtgctcactgcgtcactcaccatc
A0A7N5J9E6_BAX-01      agacagtgaccatctttgtggctggagtgctcactgcgtcactcaccatc
A0A7N5J9E6_BAX-03      agacagtgaccatctttgtggctggagtgctcactgcgtcactcaccatc
                       **************************************************

A0A7N5J9E6_BAX-02      tggaaaaagatgggctga
A0A7N5J9E6_BAX-01      tggaaaaagatgggctga
A0A7N5J9E6_BAX-03      tggaaaaagatgggctga
                       ******************

© 1998-2023Centre National de la Recherche Scientifique logoInstitut national de la sante et de la recherche médicale logoUniversité de Lyon logoLegal notice