Dataset for CDS BCL-2-like of organism Cairina moschata domestica

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A8C3BNR4_BCL2A1-      --------------------------------------------------
A0A8C3CIW8_BCL2-01      cccctcggggacttgaagcatcaaagcagccggagcttaacgtttctgaa
A0A8C3CGW6_BCL2L1-      --------------------------------------------------
A0A8C3GNC2_MCL1-01      --------------------------------------------------

A0A8C3BNR4_BCL2A1-      ---------atgg-------------------------------------
A0A8C3CIW8_BCL2-01      gacttggcgatgtttgggtcgtgtcgttgctggtgttttttgtagaggaa
A0A8C3CGW6_BCL2L1-      ---------atgtccag---------------------------------
A0A8C3GNC2_MCL1-01      ---------atgttcgc---------------------------------

A0A8C3BNR4_BCL2A1-      ----------------------------------------aaactgctga
A0A8C3CIW8_BCL2-01      acttgacagaggaacatatttatagtcccaaaagaggctacgataaccgg
A0A8C3CGW6_BCL2L1-      ----------------------------------------cggcaaccgg
A0A8C3GNC2_MCL1-01      ----------------------------------------c--ctgccgc
                                                                      * * 

A0A8C3BNR4_BCL2A1-      gttctattacgtttattatttagctcaagattat---ctgcaatatgtgc
A0A8C3CIW8_BCL2-01      gagatagt--------------gctgaagtacatccactataaactctcg
A0A8C3CGW6_BCL2L1-      gagctggt--------------gatcgactttgtcgcctacaagctgtcg
A0A8C3GNC2_MCL1-01      gc---------------------aacgccctcatcggcttcaacctctac
                        *                                *   **  **  * *  

A0A8C3BNR4_BCL2A1-      ttcaggaatcacatcttgg--accagcgcaaaccagag------------
A0A8C3CIW8_BCL2-01      cagaggggatacgactgggctgccggc-----gaggacagggcgcccgcg
A0A8C3CGW6_BCL2L1-      cagaagggctacagctgga--gccagctggaggaggaggatgagaacagg
A0A8C3GNC2_MCL1-01      tgcggcggcggcacc--gg--gcccgggggaggaggaggaggaggaggag
                                   *  *  *    ** *         **             

A0A8C3BNR4_BCL2A1-      --------------------------------------------------
A0A8C3CIW8_BCL2-01      cctacggctctcgctcctgctgctgctgcggttg----ctgctgctggga
A0A8C3CGW6_BCL2L1-      actgagg---tggcggccgaggccgacgcggtgctcaacgg-------ga
A0A8C3GNC2_MCL1-01      gaggagg---gggc--ccggcctcaacgggggggaccccggccccgccgc

A0A8C3BNR4_BCL2A1-      ------------------ttgctcatgtcttgcga---------------
A0A8C3CIW8_BCL2-01      ctccctc-----------ccgccaccgccccgccg-----ggctgctgtc
A0A8C3CGW6_BCL2L1-      gcccctc-----------ctggcacccgcccgccg---------------
A0A8C3GNC2_MCL1-01      ccccctcccctcacgccgccgcccccccccctccgttcccggcggctcgc
                                            *       *   *                 

A0A8C3BNR4_BCL2A1-      ----------------aacattgcatcttcgctgc---------------
A0A8C3CIW8_BCL2-01      cccgc-----accccgagccccccggctcggctgc---------------
A0A8C3CGW6_BCL2L1-      ----------gccaggtagtgaacggcgccgccgt---------------
A0A8C3GNC2_MCL1-01      ggcgccccctgctcgctgctgattggctccgccgccgctccgcgctcgct
                                                  *   ** *                

A0A8C3BNR4_BCL2A1-      --------------------------------------------------
A0A8C3CIW8_BCL2-01      -----------------tgctagcgaggcgcccccgggcgag------gg
A0A8C3CGW6_BCL2L1-      -----------------------------gcaccggagcggc-ctggagg
A0A8C3GNC2_MCL1-01      gattggctccgccgctccgccgttgtggagccccgaggaggagctggacg

A0A8C3BNR4_BCL2A1-      -------------------------aagatcaaacagaggaggctctcag
A0A8C3CIW8_BCL2-01      gctgcgccccgcacccc------ccgtggtccacctcgccctgcgccagg
A0A8C3CGW6_BCL2L1-      tccgcgagctc--gtccagtcggccggcgtccggcaggcgctgcgcgaag
A0A8C3GNC2_MCL1-01      gctgcgagcccgaggccgagctgggggggcccggaggaggaggggggggg
                                                      *           *      *

A0A8C3BNR4_BCL2A1-      acccttcctggaca-------ggatt------------------------
A0A8C3CIW8_BCL2-01      ------ccggggac-------gagtt------------------------
A0A8C3CGW6_BCL2L1-      ------ccggggac-------gagtt---------cgagctgaggt----
A0A8C3GNC2_MCL1-01      tctctcccggggacccccccggagttacccacggacgagttgaggcagga
                              ** **          *  **                        

A0A8C3BNR4_BCL2A1-      --------------------------------------------------
A0A8C3CIW8_BCL2-01      ----------------ctcccgtcgct-----------------------
A0A8C3CGW6_BCL2L1-      --------------------------------------------------
A0A8C3GNC2_MCL1-01      ctcgttggaactgatcctccggtacctccgggaagcggcgggggaaacgg

A0A8C3BNR4_BCL2A1-      --------------------------------------------------
A0A8C3CIW8_BCL2-01      -acca------------------gcgggacttcgc---------------
A0A8C3CGW6_BCL2L1-      -accg------------------ccgggccttcag---------------
A0A8C3GNC2_MCL1-01      aaccgggcttgaaaaagttttttccgggccttttgggaagacccgggggg

A0A8C3BNR4_BCL2A1-      --------------------------------------------------
A0A8C3CIW8_BCL2-01      --------------------------------------------------
A0A8C3CGW6_BCL2L1-      --------------------------------------------------
A0A8C3GNC2_MCL1-01      gttgcggggggggacggcgtgatggagaaagcgctggaaacgctgcggag

A0A8C3BNR4_BCL2A1-      ----------------------------gatattactt------------
A0A8C3CIW8_BCL2-01      ---------------------------ccagatgtccggcc---------
A0A8C3CGW6_BCL2L1-      ---------------------------cgacctcacctccc---------
A0A8C3GNC2_MCL1-01      ggtgggggacggagtcctggagaaacacgagctggccttccaaggaatgc
                                                     *  *  *              

A0A8C3BNR4_BCL2A1-      --------ctgtagat----------gttgccaagagaattttcaatggt
A0A8C3CIW8_BCL2-01      ------agctgcacctgacacccttcacggccagaggccgcttcgtggcc
A0A8C3CGW6_BCL2L1-      ------agctccacatcacccccggcacggcttaccagagcttcgagcag
A0A8C3GNC2_MCL1-01      ttcggaagctggaaatcaagaaggaggaagacctgcaggccgtgggtgag
                                **  *  *             *            *       

A0A8C3BNR4_BCL2A1-      gtcatggatgaaaaatttgctgatggaaatactaattggggaagaattac
A0A8C3CIW8_BCL2-01      gtggtggaggagctcttccgagacggggtg---aactggggccggatcgt
A0A8C3CGW6_BCL2L1-      gtggtgaacgaactcttccgcgatggggtg---aactgggggcgcatcgt
A0A8C3GNC2_MCL1-01      gtggcggcccacctcttcagcgacggggtgaccaactgggggcgcgtcgt
                        **   *    *    **    ** **       ** *****  *  *   

A0A8C3BNR4_BCL2A1-      gaccatatttacttttgg--------aggtcttctcactaagaagcttca
A0A8C3CIW8_BCL2-01      ggccttcttcgagttcgg------cggcgtcatgtgcgtggagagcgtca
A0A8C3CGW6_BCL2L1-      ggccttcttctccttcgg------aggggcgctgtgcgtggagagcgtcg
A0A8C3GNC2_MCL1-01      caccctcatctccttcggcgccttcgtggccaggcacctgaaaagcgtga
                          ** *  *    ** **          *         *    *** *  

A0A8C3BNR4_BCL2A1-      agaacatggagttcagctcactggagagaagaaggagcaga-tctcttat
A0A8C3CIW8_BCL2-01      accg---ggagatgtctcccctggtggacagcatcg------ccgcctgg
A0A8C3CGW6_BCL2L1-      acaa---ggagatgcgggtgctggtggggcgcatcg------tggcctgg
A0A8C3GNC2_MCL1-01      agca---ggaga---------------aaagcatcggctccctggccagg
                        *      ****                   * *            *    

A0A8C3BNR4_BCL2A1-      ttcatcacagagtacatcataaacaacaaa----------------gccg
A0A8C3CIW8_BCL2-01      atgaccgagtac-------------ctgaacc--------------ggca
A0A8C3CGW6_BCL2L1-      atgaccacctac-------------ctgagcg--------------acca
A0A8C3GNC2_MCL1-01      atcatcacggacgccctcgtctcgtccaagcgcgagtggctcgtgagcca
                         * * *    *                 *                   * 

A0A8C3BNR4_BCL2A1-      ------------------------------------------aatgga--
A0A8C3CIW8_BCL2-01      ------------------cctgcaca----------------actgga--
A0A8C3CGW6_BCL2L1-      ------------------cctcgacc----------------cctgga--
A0A8C3GNC2_MCL1-01      gggaggctgggagggtttcgtcgactttttccgagtggaagacctggaag

A0A8C3BNR4_BCL2A1-      --------------------------tagatgcaaatggtggc--tggga
A0A8C3CIW8_BCL2-01      --------------------------tccaggacaacggaggc--tggga
A0A8C3CGW6_BCL2L1-      --------------------------tccaggagaacggcgga--tggga
A0A8C3GNC2_MCL1-01      gcagcatcaggaacgtgctgatggcgttcgcgggagtggcgggactggga
                                                  *    *  *  ** **   *****

A0A8C3BNR4_BCL2A1-      aaa------------------------------------tggcttccta-
A0A8C3CIW8_BCL2-01      -tgccttcg------------------------------tggagttgtat
A0A8C3CGW6_BCL2L1-      gcg-gtttg------------------------------tggacctctac
A0A8C3GNC2_MCL1-01      gcgagcttggcctacatgatccggaaggcgtgcgccggtcggattgcgag
                                                                **      * 

A0A8C3BNR4_BCL2A1-      ----------------------------acaaagtttgaaagaag-----
A0A8C3CIW8_BCL2-01      ggcaacagtat---------------------------------------
A0A8C3CGW6_BCL2L1-      gggaacgatgctgct-------------gcggaga--tgaggaag---gg
A0A8C3GNC2_MCL1-01      gggaccgatgaggattatcgctttgggagcggaaagcggaagaagttcgg

A0A8C3BNR4_BCL2A1-      ------------------------------atcactactgtctttct---
A0A8C3CIW8_BCL2-01      ----------------gaggcctttgttcgatttctcctggatctct---
A0A8C3CGW6_BCL2L1-      ccag------------gaaaccttcaacaaatggctcct-----------
A0A8C3GNC2_MCL1-01      tcaatcggctcggtttgagagcccaaggggactgcttcggttttaccccc
                                                      *   ** *            

A0A8C3BNR4_BCL2A1-      ---------------------ccaaaattaca-------gacttattcgt
A0A8C3CIW8_BCL2-01      ---------------------ctgaagac--------------tatcctg
A0A8C3CGW6_BCL2L1-      -------------------gaccggggcgacg----------gtggccgg
A0A8C3GNC2_MCL1-01      ggagttttagcctcgcctagaccgaagcctcgtgggcttggcgtggcggg
                                             *                     *      

A0A8C3BNR4_BCL2A1-      ggc----tgttttttccttgttcagagagt--------------------
A0A8C3CIW8_BCL2-01      agt----------ttggttctggtgggagc--------------------
A0A8C3CGW6_BCL2L1-      agt------------gctcctgctgggatc--------------------
A0A8C3GNC2_MCL1-01      agcgagatattcagagcttctggtgagagcagctcctctgtcagagcttc
                         *               *  *   * **                      

A0A8C3BNR4_BCL2A1-      --------------------------------------------------
A0A8C3CIW8_BCL2-01      -----------ttgcatcactcttggc----gcttatct-----------
A0A8C3CGW6_BCL2L1-      -------------------cct---------gctgagcc-----------
A0A8C3GNC2_MCL1-01      gagtgcgagcccggcgccgcctcgggaaggagcggagccaccccgggggc

A0A8C3BNR4_BCL2A1-      -----actactga-------------------------------------
A0A8C3CIW8_BCL2-01      cggacataagtag-------------------------------------
A0A8C3CGW6_BCL2L1-      -----gcaagtga-------------------------------------
A0A8C3GNC2_MCL1-01      tggcagcaggtggcagggaggcggcggagcggggccggcgcggcgcggtg

A0A8C3BNR4_BCL2A1-      -
A0A8C3CIW8_BCL2-01      -
A0A8C3CGW6_BCL2L1-      -
A0A8C3GNC2_MCL1-01      a

© 1998-2023Legal notice