Dataset for CDS BCL2L1 of organism Seriola lalandi dorsalis

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3B4XS24_BCL2L1-      atgtcgtacagcaacagagagctggtggagttcttcataagctacaaact
A0A3B4XU17_BCL2L1-      atgtctca---aaacagagaactggtcgttttctacataaagtataagct
                        *****  *    ******** ***** *  **** *****  ** ** **

A0A3B4XS24_BCL2L1-      gtctcaaagtaactgcccaacctcactgctgaggccagaggatgctggtg
A0A3B4XU17_BCL2L1-      ctcccagagaaactatcctctcacccacatggaactcaatgagtctccca
                         ** ** ** ****  **   * * *   **   *   * **  **    

A0A3B4XS24_BCL2L1-      gaaggactga-----gggagacaaggccagctcag---ctgccagtaatg
A0A3B4XU17_BCL2L1-      acaggactgatggcggggaggcagggttggttgaggaacagcggatagcg
                          ********     ***** ** **   * * **   * **   **  *

A0A3B4XS24_BCL2L1-      gcttgttggtcaacag------cagtgacaggtgtggtcagcccggga--
A0A3B4XU17_BCL2L1-      ac--gcacgccaatggaacttttaatggcacgagt------cctgggacc
                         *  *   * ***  *       * ** ** * **      ** ****  

A0A3B4XS24_BCL2L1-      cgtcc-tcgcccccgca-tggtggca-----------------------t
A0A3B4XU17_BCL2L1-      cgtccagagtccccgcagcggcagcaacggctgccgtcaacaacgagcct
                        *****   * *******  **  ***                       *

A0A3B4XS24_BCL2L1-      agaggccgtaaagtcagcccttaaggactctgctgacgaatttgaattgc
A0A3B4XU17_BCL2L1-      ggacgcagtgaaagaggccctccgggattccgccaacgagtttgagttgc
                         ** ** ** **    *****   *** ** **  **** ***** ****

A0A3B4XS24_BCL2L1-      tcttcaaccaagcatttagtgacctttccacgcagcttgacatcactcct
A0A3B4XU17_BCL2L1-      gatactcccgcgccttcagcgatctgcacaaccagctgcatatcacgccg
                          * *  **  ** ** ** ** **   **  *****  * ***** ** 

A0A3B4XS24_BCL2L1-      gacactgcataccacagctttaagagtgtgatggatgagttgttcaagga
A0A3B4XU17_BCL2L1-      gccacagcttaccaaagctttgcgaacgtgatggatgaagtgttccggga
                        * *** ** ***** ******  **  ***********  *****  ***

A0A3B4XS24_BCL2L1-      tggagtcaactggggacgtatagtgggcctgtttgcctttgggggtgtac
A0A3B4XU17_BCL2L1-      tggcttcaactggggccgcatcatagggctttttgtgttcggcggggcgc
                        ***  ********** ** **  * ** ** ****  ** ** ** *  *

A0A3B4XS24_BCL2L1-      tgtgtgtggaatgcatacagaagaatatgagcgagctggtttcccgtatc
A0A3B4XU17_BCL2L1-      tgtgtgtcgagtgtgtggagaaggagatgagtcctctggtgggcaggatc
                        ******* ** **  *  ***** * *****    *****   * * ***

A0A3B4XS24_BCL2L1-      gcagactggatgaccatgtacctggatgagcacatcagtccgtggatcca
A0A3B4XU17_BCL2L1-      gtagagtggatgaccgtctacctggacaaccgcattcagccatggatcca
                        * *** ********* * ********  * * ***    ** ********

A0A3B4XS24_BCL2L1-      gagccaaggaggctgggactgctttgctgagatgtttgggcaagacgccg
A0A3B4XU17_BCL2L1-      gagtcaaggaggatgggagcgatttgctgaaatctttgggcaggacgcag
                        *** ******** *****  * ******** ** ******** ***** *

A0A3B4XS24_BCL2L1-      ctgcagaagcgaggagatctcgggaggctgtgaggaggtggctgctagtt
A0A3B4XU17_BCL2L1-      cagcagacagcaggaggtctcaggagagttttaagaagtggctgctggcg
                        * *****    ***** **** ****  * * * ** ********* *  

A0A3B4XS24_BCL2L1-      ggagtggcgatgttggcaggagtgctgatgggcgtgctcatcgttaagaa
A0A3B4XU17_BCL2L1-      gggatgaccctggtgaccggggttgtggtgggctcactgatcgcccaaaa
                        **  ** *  ** ** * ** **  ** *****   ** ****   * **

A0A3B4XS24_BCL2L1-      acat---taa
A0A3B4XU17_BCL2L1-      gcgcctgtga
                         *     * *

© 1998-2020Legal notice