Dataset for CDS BAK1 of Organism Cercocebus atys

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K5KTN5_BAK1-02      atggcatcagggcaaggcccagggtttcccaggcaggagtgcggagagct
A0A2K5KTN5_BAK1-03      atggcatcagggcaaggcccagggtttcccaggcaggagtgcggagagct
A0A2K5N1I8_BAK1-02      atggcttcgggacaaggcccaggtcctcccaggcaggaatgcggagagcc
A0A2K5N1I8_BAK1-01      atggcttcgggacaaggcccaggtcctcccaggcaggaatgcggagagcc
                        ***** ** ** ***********   ************ ********** 

A0A2K5KTN5_BAK1-02      tgccctgccctctgcttctgaggagcaggtaacccgggacatggagaag-
A0A2K5KTN5_BAK1-03      tgccctgccctctgcttctgaggagcaggtaacccgggacatggagaag-
A0A2K5N1I8_BAK1-02      tgccctgccctctgcttctgaggagcaggtagcccgggacacagaggagg
A0A2K5N1I8_BAK1-01      tgccctgccctctgcttctgaggagcaggtagcccgggacacagaggagg
                        ******************************* *********  *** ** 

A0A2K5KTN5_BAK1-02      --------------gtttttgaccgccatcagcaagaacaggaggctgaa
A0A2K5KTN5_BAK1-03      --------------gtttttgaccgccatcagcaagaacaggaggctgaa
A0A2K5N1I8_BAK1-02      ttttccgcagctacgttttttaccgccatcagcaggaacaggaggctgaa
A0A2K5N1I8_BAK1-01      ttttccgcagctacgttttttaccgccatcagcaggaacaggaggctgaa
                                      ****** ************* ***************

A0A2K5KTN5_BAK1-02      gggccagccgcccctgccgacccagagatggtcaccttgcccctccaacc
A0A2K5KTN5_BAK1-03      g-------------------------------------------------
A0A2K5N1I8_BAK1-02      ggggcggctgcccctgctgatccagagatggacaccttgcccctgcaacc
A0A2K5N1I8_BAK1-01      ggggcggctgcccctgctgatccagagatggacaccttgcccctgcaacc
                        *                                                 

A0A2K5KTN5_BAK1-02      tagcagcaccgtggggcaggtgggacggcagatc----------------
A0A2K5KTN5_BAK1-03      --gcagcaccgtggggcaggtgggacggcagatc----------------
A0A2K5N1I8_BAK1-02      tagcagcaccatggggcaggtgggacggcagctcgccatcatcggggacg
A0A2K5N1I8_BAK1-01      tagcagcaccatggggcaggtgggacggcagctcgccatcatcggggacg
                          ******** ******************** **                

A0A2K5KTN5_BAK1-02      --------------------------------accatgctgcagcacctg
A0A2K5KTN5_BAK1-03      --------------------------------accatgctgcagcacctg
A0A2K5N1I8_BAK1-02      acatcaaccgacgctatgactcagagttccagaccatgctgcagcagctg
A0A2K5N1I8_BAK1-01      acatcaaccgacgctatgactcagagttccagaccatgctgcagcagctg
                                                        ************** ***

A0A2K5KTN5_BAK1-02      cagcgcacagcagagaacgcctacgagtacttcaccaagatcgcctc---
A0A2K5KTN5_BAK1-03      cagcgcacagcagagaacgcctacgagtacttcaccaagatcgcctc---
A0A2K5N1I8_BAK1-02      cagcccacggcagagaacgcctatgagtacttcaccaagattgcctccag
A0A2K5N1I8_BAK1-01      cagcccacggcagagaacgcctatgagtacttcaccaagattgcctc---
                        **** *** ************** ***************** *****   

A0A2K5KTN5_BAK1-02      -----------------cagcctgtttgagagtggcatcaaccagggccg
A0A2K5KTN5_BAK1-03      -----------------cagcctgtttgagagtggcatcaaccagggccg
A0A2K5N1I8_BAK1-02      gccagcagcaacacccacagcctgtttgagagtggcatcaactggggccg
A0A2K5N1I8_BAK1-01      -----------------cagcctgtttgagagtggcatcaactggggccg
                                         *************************  ******

A0A2K5KTN5_BAK1-02      tgtggtggctctcctgggcttcagctaccatctggtcctacatgtctacc
A0A2K5KTN5_BAK1-03      tgtggtggctctcctgggcttcagctaccatctggtcctacatgtctacc
A0A2K5N1I8_BAK1-02      tgtggtggctcttctgggcttcggctaccgtctggccctacacgtctacc
A0A2K5N1I8_BAK1-01      tgtggtggctcttctgggcttcggctaccgtctggccctacacgtctacc
                        ************ ********* ****** ***** ****** *******

A0A2K5KTN5_BAK1-02      agcgcggcttgactggcttcctgggccaggtgacccgcttcgtggt---c
A0A2K5KTN5_BAK1-03      agcgcggcttgactggcttcctgggccaggtgacccgcttcgtggt---c
A0A2K5N1I8_BAK1-02      agcacggcctga--------------------------------------
A0A2K5N1I8_BAK1-01      agcacggcctgactggcttcctgggccaggtgacccgcttcgtggtcgac
                        *** **** ***                                      

A0A2K5KTN5_BAK1-02      ttcatgctgcaacactgcatcgcctggtggatcgcgcagaggggcagctg
A0A2K5KTN5_BAK1-03      ttcatgctgcaacactgcatcgcctggtggatcgcgcagaggggcagctg
A0A2K5N1I8_BAK1-02      --------------------------------------------------
A0A2K5N1I8_BAK1-01      ttcatgctgcatcactgcattgcccggtggattgcacagaggggtggctg
                                                                          

A0A2K5KTN5_BAK1-02      ggtggcagccctggacttgggcaatggtcccatcctgaacatgctggtga
A0A2K5KTN5_BAK1-03      ggtggcagccctggacttgggcaatggtcccatcctgaacatgctggtga
A0A2K5N1I8_BAK1-02      --------------------------------------------------
A0A2K5N1I8_BAK1-01      ggtggcagccctgaacttgggcaatggtcccatcctgaacgtgctggtgg
                                                                          

A0A2K5KTN5_BAK1-02      ttctgggggtggttctgttgggcccgtttgtggtacaaagattcttcaaa
A0A2K5KTN5_BAK1-03      ttctgggggtggttctgttgggcccgtttgtggtacaaagattcttcaaa
A0A2K5N1I8_BAK1-02      --------------------------------------------------
A0A2K5N1I8_BAK1-01      ttctgggtgtggttctgttgggccagtttgtggtacgaagattcttcaaa
                                                                          

A0A2K5KTN5_BAK1-02      tcatga
A0A2K5KTN5_BAK1-03      tcatga
A0A2K5N1I8_BAK1-02      ------
A0A2K5N1I8_BAK1-01      tcatga
                              

© 1998-2020Legal notice