Dataset for CDS BCL-2-like of organism Oncorhynchus kisutch

[Download (right click)] [Edit] [Sequences] [Repertoires]

14 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C7G8X1_BCL2-01      atgg--------------caaacgacgacaaccgc---------------
A0A8C7N3I9_BCL2-01      atgg--------------caaacgacgacaaccgc---------------
A0A8C7N2B4_MCL1-01      atggca----tgtc----ctgacattggtaaccgcgtcaaggc--aacgt
A0A8C7CHJ0_BCL2-01      atga------tggc--------aaacgataatcct-tataaca--gtcgc
A0A8C7H400_MCL1-01      atgagtc---tgtcgaagtcgattacacgagccac----aactacgatgt
A0A8C7H400_MCL1-02      atgagtc---tgtcgaagtcgattacacgagccac----aactacgatgt
A0A8C7H1W6_MCL1-01      atgagtctgttgtcgtcgtcgattgcccgagccac----aactacgatgt
A0A8C7H1W6_MCL1-02      atgagtctgttgtcgtcgtcgattgcccgagccac----aactacgatgt
A0A8C7FX38_BCL2L1-      ---a------tgtc--------ttacagtaacagg---gaact--ggtag
A0A8C7CBC7_BCL2L1-      ---a------tgtc--------ttacagtaacagg---gaact--ggtgg
A0A8C7CBC7_BCL2L1-      ---a------tgtc--------ttacagtaacagg---gaact--ggtgg
A0A8C7J9N8_BCL2L1-      atga------tgac--------ttacaacaacaga---gaact--ggtgg
A0A8C7IJ10_BCL2L1-      ------------at--------gtgtattaacctacctgaact--ggtgg
A0A8C7IJ10_BCL2L1-      atta------tgac--------ttacaacaacaga---gaact--ggtgg
                                                     *                    

A0A8C7G8X1_BCL2-01      tttatagtggaaa-------agtacatttgtcacaaactc----------
A0A8C7N3I9_BCL2-01      tgtatagtggaaa-------agtacatttgtcacaaactc----------
A0A8C7N2B4_MCL1-01      tgaagcatctgaa------agtggcagggtctatcgacagcactcctttg
A0A8C7CHJ0_BCL2-01      tttattgttgaaa-------aatacatacatcacaaactg----------
A0A8C7H400_MCL1-01      tgaattttcaaaatggagtcgttggaggctcttcgtaccc----------
A0A8C7H400_MCL1-02      tgaattttcaaaatggagtcgttggaggctcttcgtaccc----------
A0A8C7H1W6_MCL1-01      tgcattttcaaaa---------tggaggatcttcgtacct----------
A0A8C7H1W6_MCL1-02      tgcattttcaaaa---------tggaggatcttcgtacct----------
A0A8C7FX38_BCL2L1-      tgttttttataag-----------------ctatagactg----------
A0A8C7CBC7_BCL2L1-      tgttttttataag-----------------ctataaactg----------
A0A8C7CBC7_BCL2L1-      tgttttttataag-----------------ctataaactg----------
A0A8C7J9N8_BCL2L1-      tatactatatcac-----------------ctataaacta----------
A0A8C7IJ10_BCL2L1-      tatactatattac-----------------ctataaacta----------
A0A8C7IJ10_BCL2L1-      tatactatattac-----------------ctataaacta----------
                        *      *   *                        **            

A0A8C7G8X1_BCL2-01      -----ttgaaacgaggatatgcgtggg----atttcg-------------
A0A8C7N3I9_BCL2-01      -----ttgaaaaggggatatgcgtggg----atttcg-------------
A0A8C7N2B4_MCL1-01      ttcactagcagaggacctgaacatgagtac-agatggggagacctcgaaa
A0A8C7CHJ0_BCL2-01      -----ttgaagaagggatttgtatgggaattttatcc-------------
A0A8C7H400_MCL1-01      -----tgctgg------tacccctttgtgctatttcg-------------
A0A8C7H400_MCL1-02      -----tgctgg------tacccctttgtgctatttcg-------------
A0A8C7H1W6_MCL1-01      -----agctgatgatgctagccctttgtactatatcg-------------
A0A8C7H1W6_MCL1-02      -----agctgatgatgctagccctttgtactatatcg-------------
A0A8C7FX38_BCL2L1-      -----tcccagaggaattattcatgt-tgtcaattgg-------------
A0A8C7CBC7_BCL2L1-      -----tcccagagaaattatccatgt-tgtcagttgg-------------
A0A8C7CBC7_BCL2L1-      -----tcccagagaaattatccatgt-tgtcagttgg-------------
A0A8C7J9N8_BCL2L1-      -----tcacagagggactaccccttc-aaccacatgg-------------
A0A8C7IJ10_BCL2L1-      -----tcacagagagactaccccttc-aaccacattg-------------
A0A8C7IJ10_BCL2L1-      -----tcacagagagactaccccttc-aaccacattg-------------
                                         *     *          *               

A0A8C7G8X1_BCL2-01      -------------aggatgccgaggaggagg----aaggtgctgctaata
A0A8C7N3I9_BCL2-01      -------------agaatgcc------gagg----aagatgctgataata
A0A8C7N2B4_MCL1-01      cggatagctccttagcttacggcagcaaacactttggtgtacta------
A0A8C7CHJ0_BCL2-01      -------------agaaaacgattccccaaa----taatggttt------
A0A8C7H400_MCL1-01      -------------gcgagactggggc---tg----tacgtgctg------
A0A8C7H400_MCL1-02      -------------gcgagactggggc---tg----tacgtgctg------
A0A8C7H1W6_MCL1-01      -------------ac------ggggc---cg----tatgtgctg------
A0A8C7H1W6_MCL1-02      -------------ac------ggggc---cg----tatgtgctg------
A0A8C7FX38_BCL2L1-      -------------ggctggagggtgcaagtg----gacggactg------
A0A8C7CBC7_BCL2L1-      -------------tgctggagggtgcaagtg----gacggactg------
A0A8C7CBC7_BCL2L1-      -------------tgctggagggtgcaagtg----gacggactg------
A0A8C7J9N8_BCL2L1-      -------------agctcacagaagcccaga----atcggactg------
A0A8C7IJ10_BCL2L1-      -------------ggctcacagaagctccca----gtcggactg------
A0A8C7IJ10_BCL2L1-      -------------ggctcacagaagctccca----gtcggactg------
                                                                  *       

A0A8C7G8X1_BCL2-01      atgggtcg--------------------------------------atga
A0A8C7N3I9_BCL2-01      atgggtcg--------------------------------------atga
A0A8C7N2B4_MCL1-01      --ggagagtctgccaacatgtaccaccttccaaatacggttgacacacac
A0A8C7CHJ0_BCL2-01      --tgggga--------------------------------------gccc
A0A8C7H400_MCL1-01      ---gggcg--------------------------------------tcac
A0A8C7H400_MCL1-02      ---gggcg--------------------------------------tcac
A0A8C7H1W6_MCL1-01      ---gggcg--------------------------------------tcac
A0A8C7H1W6_MCL1-02      ---gggcg--------------------------------------tcac
A0A8C7FX38_BCL2L1-      --agggag--------------------------------------atga
A0A8C7CBC7_BCL2L1-      --aggggg--------------------------------------atga
A0A8C7CBC7_BCL2L1-      --aggggg--------------------------------------atga
A0A8C7J9N8_BCL2L1-      --aggggg--------------------------------------g---
A0A8C7IJ10_BCL2L1-      --aggggg--------------------------------------g---
A0A8C7IJ10_BCL2L1-      --aggggg--------------------------------------g---
                           *                                              

A0A8C7G8X1_BCL2-01      tttctcctcggccgggtttggcacggcggt------gccacggggccaat
A0A8C7N3I9_BCL2-01      tttctcctccgcctggtttggcacggcggt------gccacggagccaat
A0A8C7N2B4_MCL1-01      aaatgtttcatgtgta-----acctcgaaatcaagaactttgttgagaac
A0A8C7CHJ0_BCL2-01      tctccccctaact-------cccctgaagtttttgcac---ggaggtccc
A0A8C7H400_MCL1-01      cgaagtcaaaagtggatactgacttgggta------at---gggactggc
A0A8C7H400_MCL1-02      cgaagtcaaaagtggatactgacttgggta------at---gggactggc
A0A8C7H1W6_MCL1-01      cgaagtctaaagtg------gacttgggaa------at---gggaccggc
A0A8C7H1W6_MCL1-02      cgaagtctaaagtg------gacttgggaa------at---gggaccggc
A0A8C7FX38_BCL2L1-      ggccattgcaaatggg----tctgtgggga------ac---tactggaac
A0A8C7CBC7_BCL2L1-      agccattgcaaatggg----tctttgggga------ac---aacaggaac
A0A8C7CBC7_BCL2L1-      agccattgcaaatggg----tctttgggga------ac---aacaggaac
A0A8C7J9N8_BCL2L1-      -------gcaggtgga-------agggggt------gc---ggcagtcat
A0A8C7IJ10_BCL2L1-      -------acaggtgga-------agggggg------gc---ggcagtcac
A0A8C7IJ10_BCL2L1-      -------acaggtgga-------agggggg------gc---ggcagtcac
                                                                          

A0A8C7G8X1_BCL2-01      aacggcggacc---------------------------------------
A0A8C7N3I9_BCL2-01      aacgccagacc---------------------------------------
A0A8C7N2B4_MCL1-01      gacaccctgctaggtgagcacatctttcacgtgtacaacacaagcggacg
A0A8C7CHJ0_BCL2-01      aaccctccgcc---------------------------------------
A0A8C7H400_MCL1-01      gacactccaccacgacccacgaagttaggagtgaatgtcgtgaaaag---
A0A8C7H400_MCL1-02      gacactccaccacgacccacgaagttaggagtgaatgtcgtgaaaag---
A0A8C7H1W6_MCL1-01      gatactccaccacgacccacgacgttaggagtgaatgtcgtgaaaag---
A0A8C7H1W6_MCL1-02      gatactccaccacgacccacgacgttaggagtgaatgtcgtgaaaag---
A0A8C7FX38_BCL2L1-      agca------------------------------------------g---
A0A8C7CBC7_BCL2L1-      ggca------------------------------------------g---
A0A8C7CBC7_BCL2L1-      ggca------------------------------------------g---
A0A8C7J9N8_BCL2L1-      gacatac--------------------------------gtcaacgg---
A0A8C7IJ10_BCL2L1-      gacacaccccaatggcaca--------------------gtgaacgg---
A0A8C7IJ10_BCL2L1-      gacacaccccaatggcaca--------------------gtgaacgg---
                                                                          

A0A8C7G8X1_BCL2-01      --------------------------------gggcagcgtccctagtct
A0A8C7N3I9_BCL2-01      --------------------------------gggcagcgtcccccatct
A0A8C7N2B4_MCL1-01      ctgtaagtaccttaccgataggtacacgaatcgagaagacgagatgatgc
A0A8C7CHJ0_BCL2-01      ---------------------------------gaaggcgtggacactga
A0A8C7H400_MCL1-01      --------------------------------caacgtcctgggtaatca
A0A8C7H400_MCL1-02      --------------------------------caacgtcctgggtaatca
A0A8C7H1W6_MCL1-01      --------------------------------caacgtcctcgataatca
A0A8C7H1W6_MCL1-02      --------------------------------caacgtcctcgataatca
A0A8C7FX38_BCL2L1-      --------------------------------aagcaatttggcga----
A0A8C7CBC7_BCL2L1-      --------------------------------aagcaatttgggta----
A0A8C7CBC7_BCL2L1-      --------------------------------aagcaatttgggta----
A0A8C7J9N8_BCL2L1-      --------------------------------gacgagtcccggtactcc
A0A8C7IJ10_BCL2L1-      --------------------------------gacgagtcctggga---c
A0A8C7IJ10_BCL2L1-      --------------------------------gacgagtcctggga---c
                                                                          

A0A8C7G8X1_BCL2-01      ttccaaatggc-------------tctcccaaccggacccgcatgcagct
A0A8C7N3I9_BCL2-01      ttccaaacggc-------------tctcccaaacggacccgcatgcagct
A0A8C7N2B4_MCL1-01      tcttactggggaaggaacggtacaggaggggaaaaattgcattccctgat
A0A8C7CHJ0_BCL2-01      ctctccgctccaaaacag----gatcccgcaaccggaccgacatgcccgg
A0A8C7H400_MCL1-01      tttgtcagaccgaagcaacaatgacgactctgacggttctttgccctgca
A0A8C7H400_MCL1-02      tttgtcagaccgaagcaacaatgacgactctgacggttctttgccctgca
A0A8C7H1W6_MCL1-01      tttgtcagaccgaagcaacaatgacga---------ttctttgccctgca
A0A8C7H1W6_MCL1-02      tttgtcagaccgaagcaacaatgacga---------ttctttgccctgca
A0A8C7FX38_BCL2L1-      -----------------------------------------agccctcat
A0A8C7CBC7_BCL2L1-      -----------------------------------------tgccttcct
A0A8C7CBC7_BCL2L1-      -----------------------------------------tgccttcct
A0A8C7J9N8_BCL2L1-      tccaccacggca------------------------gtcgcccccctcct
A0A8C7IJ10_BCL2L1-      tccaccgcgaca------------------------gtctcccccctcgt
A0A8C7IJ10_BCL2L1-      tccaccgcgaca------------------------gtctcccccctcgt
                                                                          

A0A8C7G8X1_BCL2-01      attcacagagttttgcgtgaggccggggacgaac----------------
A0A8C7N3I9_BCL2-01      attcacagagttttgcgtgaggccggggacgaac----------------
A0A8C7N2B4_MCL1-01      agcatcatcaccaactcgaccg-gagccctggac----------------
A0A8C7CHJ0_BCL2-01      ctccatagggtgctgcgcgagg-cgggggacgag----------------
A0A8C7H400_MCL1-01      ctcctcagatggcgtcagaatg-tgggcctgaactatcgaattgtcaatc
A0A8C7H400_MCL1-02      ctcctcagatggcgtcagaatg-tgggcctgaactatcgaattgtcaatc
A0A8C7H1W6_MCL1-01      ctcctcagatggcgtcagaatg-tgggcctgaac----------------
A0A8C7H1W6_MCL1-02      ctcctcagatggcgtcagaatg-tgggcctgaac----------------
A0A8C7FX38_BCL2L1-      ctccacag-------gg-------gggcatggag----------------
A0A8C7CBC7_BCL2L1-      ctgcacaa-------gg-------gggaattgag----------------
A0A8C7CBC7_BCL2L1-      ctgcacaa-------gg-------gggaattgag----------------
A0A8C7J9N8_BCL2L1-      cccctcgg-------cggacag-cgggcctggac----------------
A0A8C7IJ10_BCL2L1-      cccctcag-------cggacaa-tgggcctggac----------------
A0A8C7IJ10_BCL2L1-      cccctcag-------cggacaa-tgggcctggac----------------
                                                 *      *                 

A0A8C7G8X1_BCL2-01      -------------tcgaaa-----------------------gactgtac
A0A8C7N3I9_BCL2-01      -------------tcgaac-----------------------gactgtac
A0A8C7N2B4_MCL1-01      ------------accgaca-------ccaggcaactcattaaatgtgtcc
A0A8C7CHJ0_BCL2-01      ------------attgaaa-----------------------taatgtat
A0A8C7H400_MCL1-01      gggcgatgaagtattggaacatgatacaagacaactaattgaaaacgtat
A0A8C7H400_MCL1-02      gggcgatgaagtattggaacatgatacaagacaactaattgaaaacgtat
A0A8C7H1W6_MCL1-01      -----------tattggaacatgataccagacaactcattgatgatatgt
A0A8C7H1W6_MCL1-02      -----------tattggaacatgataccagacaactcattgatgatatgt
A0A8C7FX38_BCL2L1-      ----------ccagtgaaa------------------------gcagcac
A0A8C7CBC7_BCL2L1-      ----------gcggtgaaa------------------------gcagcac
A0A8C7CBC7_BCL2L1-      ----------gcggtgaaa------------------------gcagcac
A0A8C7J9N8_BCL2L1-      ----------gcagtgaaa------------------------gaggcat
A0A8C7IJ10_BCL2L1-      ----------gcagtgaaa------------------------gaggcat
A0A8C7IJ10_BCL2L1-      ----------gcagtgaaa------------------------gaggcat
                                       *                                  

A0A8C7G8X1_BCL2-01      cagcccgactttgcagagatgtcaca------------------------
A0A8C7N3I9_BCL2-01      cagcccgactttgcggagatgtcaca------------------------
A0A8C7N2B4_MCL1-01      t-aggacaatgtacgggacttctgaaacctaggtggaacgaaagcaaagc
A0A8C7CHJ0_BCL2-01      cagcgggactttgcagagatgtcggggc----------------------
A0A8C7H400_MCL1-01      t-ggtggactatacaggactgt------ctcgttgtaagcaaagcaaggc
A0A8C7H400_MCL1-02      t-ggtggactatacaggactgt------ctcgttgtaagcaaagcaaggc
A0A8C7H1W6_MCL1-01      t-gagggaatacacaggactgtctcagcctcgatggaagcaaagcaagta
A0A8C7H1W6_MCL1-02      t-gagggaatacacaggactgtctcagcctcgatggaagcaaagcaagta
A0A8C7FX38_BCL2L1-      t-acgggactcagtggatgagtttgagctgcg------------------
A0A8C7CBC7_BCL2L1-      t-acgggactcagtggatgagtttgagctgcg------------------
A0A8C7CBC7_BCL2L1-      t-acgggactcagtggatgagtttgagctgcg------------------
A0A8C7J9N8_BCL2L1-      t-gcgggactctgccaacgagtttgagctgcg------------------
A0A8C7IJ10_BCL2L1-      t-gcgggactctgccaacgagtttgagctgcg------------------
A0A8C7IJ10_BCL2L1-      t-gcgggactctgccaacgagtttgagctgcg------------------
                               * *                                        

A0A8C7G8X1_BCL2-01      --------------------------------------------------
A0A8C7N3I9_BCL2-01      --------------------------------------------------
A0A8C7N2B4_MCL1-01      tctgtcaacaatgagtagagttatcgggcagttactagagaagcacagat
A0A8C7CHJ0_BCL2-01      --------------------------------------------------
A0A8C7H400_MCL1-01      tcttacgacgatgaagcgagtggtgaaggatataatagcaaagcaccgat
A0A8C7H400_MCL1-02      tcttacgacgatgaagcgagtggtgaaggatataatagcaaagcaccgat
A0A8C7H1W6_MCL1-01      tcttacgaccatgaagcgagtggtggaggacgtaatagcaaagcaccgat
A0A8C7H1W6_MCL1-02      tcttacgaccatgaagcgagtggtggaggacgtaatagcaaagcaccgat
A0A8C7FX38_BCL2L1-      --ctacacccgc--------------------------------------
A0A8C7CBC7_BCL2L1-      --ttacacccgt--------------------------------------
A0A8C7CBC7_BCL2L1-      --ttacacccgt--------------------------------------
A0A8C7J9N8_BCL2L1-      --ttatgccaga--------------------------------------
A0A8C7IJ10_BCL2L1-      --ttatgccaga--------------------------------------
A0A8C7IJ10_BCL2L1-      --ttatgccaga--------------------------------------
                                                                          

A0A8C7G8X1_BCL2-01      ----------------------ccagctgtat----ctcacatcctccac
A0A8C7N3I9_BCL2-01      ----------------------ccaattgtat----ctcacgtcttctat
A0A8C7N2B4_MCL1-01      acacatacaacggtatgatcaacacactctatgtggatgacagaggggat
A0A8C7CHJ0_BCL2-01      ------------------------agttgcat----tttacgcccagtac
A0A8C7H400_MCL1-01      acgcatacaatggtatgatcgccaaacttgacttagatgaccgatgcgat
A0A8C7H400_MCL1-02      acgcatacaatggtatgatcgccaaacttgacttagatgaccgatgcgat
A0A8C7H1W6_MCL1-01      atgcatacaatggtatggtcgtcaaacttgacttggatgatcgatgcgat
A0A8C7H1W6_MCL1-02      atgcatacaatggtatggtcgtcaaacttgacttggatgatcgatgcgat
A0A8C7FX38_BCL2L1-      --gccttcagtgacctctcctcccagctccac----atcacccctgccac
A0A8C7CBC7_BCL2L1-      --gccttcagtgacctctgctcccagctccac----atcacccctgccac
A0A8C7CBC7_BCL2L1-      --gccttcagtgacctctgctcccagctccac----atcacccctgccac
A0A8C7J9N8_BCL2L1-      --gctttcagtgacctgtcctcccagctacac----atcacgccgtccac
A0A8C7IJ10_BCL2L1-      --gcgttcagtgacctgtcctcccagctacac----atcacgccggccac
A0A8C7IJ10_BCL2L1-      --gcgttcagtgacctgtcctcccagctacac----atcacgccggccac
                                                   *  *      * *        * 

A0A8C7G8X1_BCL2-01      ggctgagaggagatttagagaggtgatagacgagc---tgttcagggatg
A0A8C7N3I9_BCL2-01      ggcagaaaggagattcagagaggtgatagacgagc---tgttcagggacg
A0A8C7N2B4_MCL1-01      aacgt----gaagttcctcagtgcagtagcccatagcatctttgaagacg
A0A8C7CHJ0_BCL2-01      ggcacagagaaggtttactgctgttatagaggagc---tcttcagcgacg
A0A8C7H400_MCL1-01      gacat----gagtttcatcaattctgtggccaagaccctgttcagtgatg
A0A8C7H400_MCL1-02      gacat----gagtttcatcaattctgtggccaagaccctgttcagtgatg
A0A8C7H1W6_MCL1-01      gacat----gagcgtcgtcaattctgtggccaagaccatgttcagtgatg
A0A8C7H1W6_MCL1-02      gacat----gagcgtcgtcaattctgtggccaagaccatgttcagtgatg
A0A8C7FX38_BCL2L1-      agcctaccacagctttgagagtgtgatggacgaag---tgttcagggacg
A0A8C7CBC7_BCL2L1-      agcctaccacagctttgagagcgtgatggacgaag---tgttcagggacg
A0A8C7CBC7_BCL2L1-      agcctaccacagctttgagagcgtgatggacgaag---tgttcagggacg
A0A8C7J9N8_BCL2L1-      agcctatcagagctttgagaacgtgatggacgagg---tgttccgggacg
A0A8C7IJ10_BCL2L1-      agcctaccagagcttcgagaacgtgatggatgagg---ttttccgtgacg
A0A8C7IJ10_BCL2L1-      agcctaccagagcttcgagaacgtgatggatgagg---ttttccgtgacg
                          *       *   *           * *   *     * **    ** *

A0A8C7G8X1_BCL2-01      gggtt---aactggggacggattatcgccttcttcgagttcgggggcaca
A0A8C7N3I9_BCL2-01      gggtt---aactggggacgaattgtcgccttcttcgagttcggtggcaca
A0A8C7N2B4_MCL1-01      ggaccgtcaactggggccgtgttgccagcctgacatcttttggggctgcg
A0A8C7CHJ0_BCL2-01      gtgta---aactggggtcggattgtggctttctttgaatttggagggaca
A0A8C7H400_MCL1-01      ggaccacgaactggggtcgcatcgccagcctggtggcatttggagcagtg
A0A8C7H400_MCL1-02      ggaccacgaactggggtcgcatcgccagcctggtggcatttggagcagtg
A0A8C7H1W6_MCL1-01      ggatcacgaactggggtcgcatcgccagcctggtggcatttggcgcagtg
A0A8C7H1W6_MCL1-02      ggatcacgaactggggtcgcatcgccagcctggtggcatttggcgcagtg
A0A8C7FX38_BCL2L1-      gggtc---aactggggtcgcgtggtgggtctgtttgctttcggtggggcc
A0A8C7CBC7_BCL2L1-      gggtc---aactggggtcgcgtggtgggcctgtttgcttttggcggggcc
A0A8C7CBC7_BCL2L1-      gggtc---aactggggtcgcgtggtgggcctgtttgcttttggcggggcc
A0A8C7J9N8_BCL2L1-      gtgtc---aactggggacgggtggtgggcctgtttgctttcggaggggcc
A0A8C7IJ10_BCL2L1-      gtgtg---aactggggacgtgtggtgggcctgtttgccttcggaggggcc
A0A8C7IJ10_BCL2L1-      gtgtg---aactggggacgtgtggtgggcctgtttgccttcggaggggcc
                        *       ******** **  *        *       ** ** *     

A0A8C7G8X1_BCL2-01      atatgcgtggaatgcgtgaacaaggagatgacgtcg---------caggt
A0A8C7N3I9_BCL2-01      atatgtgtggaatgcgtgaacaaggaaatgacgtcg---------caggt
A0A8C7N2B4_MCL1-01      gtgtgccggtacttgagaggcaaggggagagacaactgtgtggatttggt
A0A8C7CHJ0_BCL2-01      atgtgcgtggagagcgtcaaccgggagatgacgtcc---------caggt
A0A8C7H400_MCL1-01      gtgagccagcacttgaaggagattggcaggggacactgcattgagtcggt
A0A8C7H400_MCL1-02      gtgagccagcacttgaaggagattggcaggggacactgcattgagtcggt
A0A8C7H1W6_MCL1-01      gtgagccagcacctgaaggagagtggcaggggacactgcgttgatttggt
A0A8C7H1W6_MCL1-02      gtgagccagcacctgaaggagagtggcaggggacactgcgttgatttggt
A0A8C7FX38_BCL2L1-      ttgtgtgttgagtgtgttgagaaggatatgagccca---------ctggt
A0A8C7CBC7_BCL2L1-      ctgtgcgttgagtgtgttgagaaggatatgagccac---------ctggt
A0A8C7CBC7_BCL2L1-      ctgtgcgttgagtgtgttgagaaggatatgagccac---------ctggt
A0A8C7J9N8_BCL2L1-      ctctgtgtagaatgtgtggacaaggagatgaacccc---------ttggt
A0A8C7IJ10_BCL2L1-      ctctgtgtagagtgtgtggagaaggagatgagccca---------ctagt
A0A8C7IJ10_BCL2L1-      ctctgtgtagagtgtgtggagaaggagatgagccca---------ctagt
                         *  *     *             *  *                    **

A0A8C7G8X1_BCL2-01      ggatcacatcgcggtgtggatgacagagtatctaaatggaccactgctca
A0A8C7N3I9_BCL2-01      tgaccacatcgccgggtggatgacggagtatctaaatggaccgctgcaca
A0A8C7N2B4_MCL1-01      gggagagg---------agatatcagagtacctggtcactcaccacaagg
A0A8C7CHJ0_BCL2-01      agacaacattgcccattggatgacagagtacctgaacggacccctgcaga
A0A8C7H400_MCL1-01      gggccaaa---------agatcgccacatacct-------cctctctgac
A0A8C7H400_MCL1-02      gggccaaa---------agatcgccacatacct-------cctctctgac
A0A8C7H1W6_MCL1-01      gggccgag---------agattgccacatacct-------cctctctgac
A0A8C7H1W6_MCL1-02      gggccgag---------agattgccacatacct-------cctctctgac
A0A8C7FX38_BCL2L1-      ggcgcgcatcgcagattggatgaccacatacctggacaaccatatccagc
A0A8C7CBC7_BCL2L1-      gacgcgcatcgcagactggatggccacctacctggacaaccatatccagc
A0A8C7CBC7_BCL2L1-      gacgcgcatcgcagactggatggccacctacctggacaaccatatccagc
A0A8C7J9N8_BCL2L1-      gggaaggatcacagactggatgaccgtctatctggacaaccacatccagc
A0A8C7IJ10_BCL2L1-      gggacggattgcagactggatgactgtatacctggacaaccacattcagc
A0A8C7IJ10_BCL2L1-      gggacggattgcagactggatgactgtatacctggacaaccacattcagc
                                          ***  *    ** **       *         

A0A8C7G8X1_BCL2-01      a-------ctggattcagg----agaacgggggatgggaggcttttgttg
A0A8C7N3I9_BCL2-01      a-------ctggattcaag----agaacgggggatgggaggcctttgttg
A0A8C7N2B4_MCL1-01      a-------ctggct----agtcaaacataactcctggaatgggttcgtgg
A0A8C7CHJ0_BCL2-01      a-------ctggatccagg----agaatggtgactgggacgcctttgtgg
A0A8C7H400_MCL1-01      caaagggactggct----ggtcaaaaacaatgcttggaatggatttgtag
A0A8C7H400_MCL1-02      caaagggactggct----ggtcaaaaacaatgcttggaatggatttgtag
A0A8C7H1W6_MCL1-01      caaagggactggct----ggtcaaaaacaatgcttggaatggatttgtag
A0A8C7H1W6_MCL1-02      caaagggactggct----ggtcaaaaacaatgcttggaatggatttgtag
A0A8C7FX38_BCL2L1-      c-------ctggatccagagccaaggagga----tgggaccattttgcag
A0A8C7CBC7_BCL2L1-      c-------ctggatccagagccaaggagga----tgggaccgttttgcgg
A0A8C7CBC7_BCL2L1-      c-------ctggatccagagccaaggagga----tgggaccgttttgcgg
A0A8C7J9N8_BCL2L1-      c-------ctggatccagagccaaggagga----tgggaccggtttgcag
A0A8C7IJ10_BCL2L1-      c-------ctggatccagagccaaggagga----tgggaccggtttgcag
A0A8C7IJ10_BCL2L1-      c-------ctggatccagagccaaggagga----tgggaccggtttgcag
                                **** *         *  *       *** *    ** *  *

A0A8C7G8X1_BCL2-01      agctcta---tgacagacagagggactcggtgttctg-------ttcgtg
A0A8C7N3I9_BCL2-01      agctcta---tgacagacagagggactccgtgttcgg-------ttcatg
A0A8C7N2B4_MCL1-01      agttctttccagtagcagaacctgagtccagatgtcggaacatcatcatg
A0A8C7CHJ0_BCL2-01      agatcta---tgg-------gcagcagaggatctctgccttccactcctg
A0A8C7H400_MCL1-01      agttctttcatgtgcaagatccagagtcctcagtaaggaacaccctcata
A0A8C7H400_MCL1-02      agttctttcatgtgcaagatccagagtcctcagtaaggaacaccctcata
A0A8C7H1W6_MCL1-01      agttttttcatgttcaagatcctgagtcctcggtaaggaacaccctccta
A0A8C7H1W6_MCL1-02      agttttttcatgttcaagatcctgagtcctcgaaaatggactatgcccgc
A0A8C7FX38_BCL2L1-      agatctt---tggcagagatgctgctgcagatgttcgacg-gtcccagga
A0A8C7CBC7_BCL2L1-      agatctt---cggcagagatgcagctgcagacgtccgacg-gtcccagga
A0A8C7CBC7_BCL2L1-      agatctt---cggcagagatgcagctgcagacgtccgacg-gtcccagga
A0A8C7J9N8_BCL2L1-      agatctt---tgggatggacgctgcagccgagagcaggaa-gtctcagga
A0A8C7IJ10_BCL2L1-      agatctt---tgggaaggacgctgcagctgagagcaggaa-gtctcagga
A0A8C7IJ10_BCL2L1-      agatctt---tgggaaggacgctgcagctgagagcaggaa-gtctcagga
                        ** * *     *           *                          

A0A8C7G8X1_BCL2-01      gccgtccatcaagaccgtcttcggcctggctgcactgggggccgcaagcc
A0A8C7N3I9_BCL2-01      gccgtccatcaagactgtctttggcctggctgcactgggggccgcaagcc
A0A8C7N2B4_MCL1-01      accatttttggattggctggta-ttggggcaacaatgaccttc---ttgg
A0A8C7CHJ0_BCL2-01      gccctacctaaagacagtgttcggcctggccgccctgggtgcagccggag
A0A8C7H400_MCL1-01      gcctttgctggatttgctgggc-ttggggcaactctcgccatg---ttga
A0A8C7H400_MCL1-02      gcctttgctggatttgctgggc-ttggggcaactctcgccatg---ttga
A0A8C7H1W6_MCL1-01      gcctttgctggagttgctggga-ttggggcaacacttgccatg---ttga
A0A8C7H1W6_MCL1-02      aagttctctgaaatccttgata------gcacca-------------tgg
A0A8C7FX38_BCL2L1-      gaacataattaaatggctgctagttggggtgattctgctttca---ggag
A0A8C7CBC7_BCL2L1-      gagcttaaaaaaatggctgctagttggggtgatgctgctttca---ggag
A0A8C7CBC7_BCL2L1-      gagcttaaaaaaatggctgctagttggggtgatgctgctttca---ggag
A0A8C7J9N8_BCL2L1-      gagctttaagaagtggtttctggcggggatgaccctggtcaca---ggag
A0A8C7IJ10_BCL2L1-      gagctttaagaagtggttgcttgctgggatgacactggttaca---ggag
A0A8C7IJ10_BCL2L1-      gagctttaagaagtggttgcttgctgggatgacactggttaca---ggag
                                   *     *                                

A0A8C7G8X1_BCL2-01      ttaccatcggagcataccttacacagaag---------------------
A0A8C7N3I9_BCL2-01      ttaccatcggagcttaccttacacagaag---------------------
A0A8C7N2B4_MCL1-01      ttatg---------------------------------------------
A0A8C7CHJ0_BCL2-01      tcaccattggagccttgttcatccagaag---------------------
A0A8C7H400_MCL1-01      tcagacagtgccctgctctaccccaggggtgtgtg---------------
A0A8C7H400_MCL1-02      tca------------------------ggaattca---------------
A0A8C7H1W6_MCL1-01      tcagaaagtgccctgctctaccccaggggtgtgtg---------------
A0A8C7H1W6_MCL1-02      ttggaatgag--------taccca--------------------------
A0A8C7FX38_BCL2L1-      tgctggtcggcactctcatcatgaagaaacgccaa---------------
A0A8C7CBC7_BCL2L1-      tactggtcggcactctcatcatgaagaaatgccag---------------
A0A8C7CBC7_BCL2L1-      tactggtcggcactctcatcatgaagaaatgccagtttgtgtgttaccct
A0A8C7J9N8_BCL2L1-      tcgtcgtagggtcactcttcgctcagaaacgcctg---------------
A0A8C7IJ10_BCL2L1-      tcatcgtagggtcactcattgctcagaaacgcctg---------------
A0A8C7IJ10_BCL2L1-      tcatcgtagggtcactcattgctcagaaacgcctg---------------
                        *                                                 

A0A8C7G8X1_BCL2-01      --------------------------------------------------
A0A8C7N3I9_BCL2-01      --------------------------------------------------
A0A8C7N2B4_MCL1-01      --------------------------------------------------
A0A8C7CHJ0_BCL2-01      --------------------------------------------------
A0A8C7H400_MCL1-01      --------------------------------------------------
A0A8C7H400_MCL1-02      --------------------------------------------------
A0A8C7H1W6_MCL1-01      --------------------------------------------------
A0A8C7H1W6_MCL1-02      --------------------------------------------------
A0A8C7FX38_BCL2L1-      --------------------------------------------------
A0A8C7CBC7_BCL2L1-      --------------------------------------------------
A0A8C7CBC7_BCL2L1-      gtataccctaggaccaactacatacattctttccaaatggacactttaca
A0A8C7J9N8_BCL2L1-      --------------------------------------------------
A0A8C7IJ10_BCL2L1-      --------------------------------------------------
A0A8C7IJ10_BCL2L1-      --------------------------------------------------
                                                                          

A0A8C7G8X1_BCL2-01      --------------------------------------------------
A0A8C7N3I9_BCL2-01      --------------------------------------------------
A0A8C7N2B4_MCL1-01      --------------------------------------------------
A0A8C7CHJ0_BCL2-01      --------------------------------------------------
A0A8C7H400_MCL1-01      --------------------------------------------------
A0A8C7H400_MCL1-02      --------------------------------------------------
A0A8C7H1W6_MCL1-01      --------------------------------------------------
A0A8C7H1W6_MCL1-02      --------------------------------------------------
A0A8C7FX38_BCL2L1-      --------------------------------------------------
A0A8C7CBC7_BCL2L1-      --------------------------------------------------
A0A8C7CBC7_BCL2L1-      taacattgaagattctaaaatattgtttttatttagtgtgctccaagaag
A0A8C7J9N8_BCL2L1-      --------------------------------------------------
A0A8C7IJ10_BCL2L1-      --------------------------------------------------
A0A8C7IJ10_BCL2L1-      --------------------------------------------------
                                                                          

A0A8C7G8X1_BCL2-01      --------------------------------------------------
A0A8C7N3I9_BCL2-01      --------------------------------------------------
A0A8C7N2B4_MCL1-01      --------------------------------------------------
A0A8C7CHJ0_BCL2-01      --------------------------------------------------
A0A8C7H400_MCL1-01      --------------------------------------------------
A0A8C7H400_MCL1-02      --------------------------------------------------
A0A8C7H1W6_MCL1-01      --------------------------------------------------
A0A8C7H1W6_MCL1-02      --------------------------------------------------
A0A8C7FX38_BCL2L1-      --------------------------------------------------
A0A8C7CBC7_BCL2L1-      --------------------------------------------------
A0A8C7CBC7_BCL2L1-      ttaaaccaaacctgttttcatttgacattttctttaagtgttccgttcct
A0A8C7J9N8_BCL2L1-      --------------------------------------------------
A0A8C7IJ10_BCL2L1-      --------------------------------------------------
A0A8C7IJ10_BCL2L1-      --------------------------------------------------
                                                                          

A0A8C7G8X1_BCL2-01      ------------tga
A0A8C7N3I9_BCL2-01      ------------tga
A0A8C7N2B4_MCL1-01      ------------tga
A0A8C7CHJ0_BCL2-01      ------------tga
A0A8C7H400_MCL1-01      ---gtgtgtttgtga
A0A8C7H400_MCL1-02      ---gcagattag---
A0A8C7H1W6_MCL1-01      ---gtgtgtttgtga
A0A8C7H1W6_MCL1-02      -----------gtga
A0A8C7FX38_BCL2L1-      ------------tga
A0A8C7CBC7_BCL2L1-      ------------tga
A0A8C7CBC7_BCL2L1-      tccttgctgtgctga
A0A8C7J9N8_BCL2L1-      ------------tga
A0A8C7IJ10_BCL2L1-      ------------tga
A0A8C7IJ10_BCL2L1-      ------------tga
                                       

© 1998-2022Legal notice